Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU063971

Sigma-Aldrich

MISSION® esiRNA

targeting human CALCR

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCCTGCAACTATTTCTGGATGCTCTGTGAAGGGATCTATCTTCATACACTCATTGTCGTGGCTGTGTTTACTGAGAAGCAACGCTTGCGGTGGTATTATCTCTTGGGCTGGGGGTTCCCGCTGGTGCCAACCACTATCCATGCTATTACCAGGGCCGTGTACTTCAATGACAACTGCTGGCTGAGTGTGGAAACCCATTTGCTTTACATAATCCATGGACCTGTCATGGCGGCACTTGTGGTCAATTTCTTCTTTTTGCTCAACATTGTCCGGGTGCTTGTGACCAAAATGAGGGAAACCCATGAGGCGGAATCCCACATGTACCTGAAGGCTGTGAAGGCCACCATGATCCTTGTGCCCCTGCTGGGAATCCAGTTTGTCGTCTTTCCCTGGAGACCTTCCAACAAGATGCTTGGGAAGATATATGATTACGTGATGCACTCTCTGATTCATTTCCAGGGCTTCTTTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Barbara Toffoli et al.
Clinical science (London, England : 1979), 134(17), 2337-2352 (2020-08-29)
TNF-related apoptosis-inducing ligand (TRAIL) has attracted attention not only as an anti-cancer agent, but also as a potential treatment for diabetes. Animal studies have shown that TRAIL delivery ameliorated glucose control in type 1 and type 2 diabetes. It is
Ruo Feng et al.
Diagnostic pathology, 10, 149-149 (2015-08-27)
Hepatocellular carcinoma (HCC) is one of the most frequent cancers in the world. Calreticulin(CRT) is aberrantly overexpressed in many human cancer cells. The function of CRT in HCC cells remains unclear. We attempted to investigate the effects and the underlying
Saurabh Vig et al.
Cell cycle (Georgetown, Tex.), 14(14), 2274-2284 (2015-05-07)
Calreticulin (CRT) is an endoplasmic reticulum (ER) resident calcium binding protein that is involved in several cellular activities. Transcriptome analyses in CRT knockdown HepG2 cells revealed 253 altered unique genes and subsequent in silico protein-protein interaction network and MCODE clustering
Beatrice Rondinelli et al.
Nucleic acids research, 43(5), 2560-2574 (2015-02-26)
DNA replication is a tightly regulated process that initiates from multiple replication origins and leads to the faithful transmission of the genetic material. For proper DNA replication, the chromatin surrounding origins needs to be remodeled. However, remarkably little is known
Xuemin Wang et al.
PloS one, 10(4), e0125402-e0125402 (2015-05-01)
Cisplatin is one of the first-line platinum-based chemotherapeutic agents for treatment of many types of cancer, including ovary cancer. CTR1 (copper transporter 1), a transmembrane solute carrier transporter, has previously been shown to increase the cellular uptake and sensitivity of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique