Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU060601

Sigma-Aldrich

MISSION® esiRNA

targeting human DNMT1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGCCACAGATGCTGACAAATGAGAAGCTGTCCATCTTTGATGCCAACGAGTCTGGCTTTGAGAGTTATGAGGCGCTTCCCCAGCACAAACTGACCTGCTTCAGTGTGTACTGTAAGCACGGTCACCTGTGTCCCATCGACACCGGCCTCATCGAGAAGAATATCGAACTCTTCTTTTCTGGTTCAGCAAAACCAATCTATGATGATGACCCATCTCTTGAAGGTGGTGTTAATGGCAAAAATCTTGGCCCCATAAATGAATGGTGGATCACTGGCTTTGATGGAGGTGAAAAGGCCCTCATCGGCTTCAGCACCTCATTTGCCGAATACATTCTGATGGATCCCAGTCCCGAGTATGCGCCCATATTTGGGCTGATGCAGGAGAAGATCTACATCAGCAAGATTGTGGTGGAGTTCCTGCAGAGCAATTCCGACTCGACCTATGAGGACCTGATCAACAAGATCGAGACCACGGTTCCTCCTTCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Arunagiri Kuha Deva Magendhra Rao et al.
Molecular oncology, 13(6), 1342-1355 (2019-04-09)
Breast cancer is the most common malignancy among women, with the highest incidence rate worldwide. Dysregulation of long noncoding RNAs during the preliminary stages of breast carcinogenesis is poorly understood. In this study, we performed RNA sequencing to identify long
Shuhao Fu et al.
Experimental eye research, 165, 47-58 (2017-09-13)
The principle reason of high failure rate of glaucoma filtration surgery is the loss of filtration function caused by postoperative scar formation. We investigated the effects of 5-aza-2'-deoxycytidine (5-Aza-dc), a DNA methyltransferases inhibitor, on human Tenon's capsule fibroblasts (HTFs) differentiation
Sumadi Lukman Anwar et al.
World journal of gastroenterology, 23(9), 1568-1575 (2017-03-23)
To screen clinically relevant microRNAs (miRNAs) silenced by DNA methylation in human hepatocellular carcinoma (HCC). Knockdown of DNA methyltransferases (DNMTs) using siRNAs and miRNA profiling in HCC cell lines were performed to identify DNA hypermethylation-mediated miRNA downregulation. Confirmation using individual
Ercan Cacan
Cell biology international, 41(3), 328-339 (2017-01-12)
The immunological response against cancer is a critical balance between immune-activating and immune-suppressing mechanisms. Ovarian cancer creates a suppressive microenvironment to escape immune elimination; however, the molecular mechanisms are poorly understood, and it is unclear whether chemotherapeutic drugs exert an
Luc Gailhouste et al.
Cell death & disease, 9(5), 468-468 (2018-04-28)
Curative management of pancreatic adenocarcinoma is limited because this malignancy remains resistant to most chemotherapeutic drugs. Strategies that reverse epigenetic alterations offer a unique opportunity for cancer cell reprogramming, which is valuable for development of new treatments. The aim of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique