Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU059281

Sigma-Aldrich

MISSION® esiRNA

targeting human TCF12

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCATCCTGGGCTTAGTGAAACTACCAACCCTATGGGTCATATGTAAACATCAGCCAGTTCCAGAGTTATCAGTAGGCTAGATAGAAGGTGACCTCTCCTCATAAGGACTTGGACAACTCAGATTATCTGAAGACACAAACCTGACAGGAGGGAGAAGAAAAAACAAAACACTTGAACCAAGAAACTCAAATGTAATCCTACGATCAAAGCAACTGGTCAACACTTCCATCAGAAGTGAAGATAGGAAGCTCATCAGATAGAACATCAGCCCATGAGATGTTTGCAACAAATCTTTTGTTGCAAGCAGTGTGTCGCTTCTGCACAATCAGAGACTGTCTCGATCTCTCCACTCACCGTGGAAGTTGCCTTGTGCCTAAACTGAATTGACAAATGCATTGTAACTACAAATTTTATTTATTGTTATGAAACTGTAAGGTCTACATATAAAGGGAAAAAGTTAATGTGGAAAGCTGATCTACACTCAGCTGATGCCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Paulo R D V Godoy et al.
Molecular medicine reports, 14(6), 5253-5260 (2016-10-26)
Glioblastoma multiforme (GBM) is a lethal tumor and novel strategies are required to overcome resistance. Transcription factor 12 (HEB) has been associated with neural and stem cell proliferation, is overexpressed in certain tumor types and is induced in irradiated U87MG cells.
Leila Pirhaji et al.
Nature communications, 8(1), 623-623 (2017-09-22)
The immense and growing repositories of transcriptional data may contain critical insights for developing new therapies. Current approaches to mining these data largely rely on binary classifications of disease vs. control, and are not able to incorporate measures of disease
Duo Wen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(8), 6211-6221 (2015-03-11)
Malic enzyme 1 (ME1) links the glycolytic and citric acid cycles and is important for NADPH production, glutamine metabolism, and lipogenesis. Recently, its deregulation has been implicated in the progression of various cancers. However, the role of ME1 in the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique