Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU052901

Sigma-Aldrich

MISSION® esiRNA

targeting human GDF15

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGGTGCAAGTGACCATGTGCATCGGCGCGTGCCCGAGCCAGTTCCGGGCGGCAAACATGCACGCGCAGATCAAGACGAGCCTGCACCGCCTGAAGCCCGACACGGTGCCAGCGCCCTGCTGCGTGCCCGCCAGCTACAATCCCATGGTGCTCATTCAAAAGACCGACACCGGGGTGTCGCTCCAGACCTATGATGACTTGTTAGCCAAAGACTGCCACTGCATATGAGCAGTCCTGGTCCTTCCACTGTGCACCTGCGCGGAGGACGCGACCTCAGTTGTCCTGCCCTGTGGAATGGGCTCAAGGTTCCTGAGACACCCGATTCCTGCCCAAACAGCTGTATTTATATAAGTCTGTTATTTATTATTAATTTATTGGGGTGACCTTCTTGGGGACTCGG

Numéro d'accès Ensembl | humain

ENSG00000130513

Numéro d'accès NCBI

NM_004864

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GDF15(9518) , GDF15(9518)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yixin Zhang et al.
Oncotarget, 8(22), 36531-36544 (2017-04-08)
Ischemia reperfusion (I/R) injury which inevitably occurs during heart transplantation is the major factor leading to organ failure and graft rejection. In order to develop new therapies to prevent I/R injury, we used both a murine heart transplantation model with
Maria Louca et al.
Cancers, 11(8) (2019-08-16)
Glioblastoma multiforme (GBM) is the most aggressive type of brain tumor due to its invasive phenotype. Ras suppressor 1 (RSU-1) is a cell-extracellular matrix adhesion protein and we recently found that it promotes cell invasion in aggressive cells and inhibits
Yanwei Lu et al.
Cell death & disease, 8(9), e3036-e3036 (2017-09-08)
CDP138, a CDK5 binding partner, regulates cell proliferation and migration. However, the mechanisms by which CDP138 functions in these processes remain unclear. In this study, we show that CDP138 is frequently overexpressed and that high levels of CDP138 are correlated
Kathrin Ackermann et al.
Atherosclerosis, 281, 128-136 (2019-01-19)
Growth differentiation factor-15 (GDF-15)/macrophage inhibitory cytokine-1 (MIC-1/GDF15) is associated with cardiovascular disease, inflammation and development of atherosclerosis and is highly expressed in macrophages (MΦ) of atherosclerotic lesions. Thus, we were interested in investigating the influence of GDF-15 in lipid homeostasis
Kirti Kumar Tiwari et al.
Toxicology in vitro : an international journal published in association with BIBRA, 29(7), 1369-1376 (2015-05-26)
GDF15 (growth and differentiation factor 15) is a secreted cytokine, a direct target of p53 and plays a role in cell proliferation and apoptosis. It is induced by oxidative stress and has anti-apoptotic effects. The role of GDF15 in hyperoxic
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique