Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU051311

Sigma-Aldrich

MISSION® esiRNA

targeting human CHD7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGTCCGCATGCTGTACTACCTAAGACAAGAAGTGATAGGAGACCAGGCGGATAAGATCTTAGAGGGTGCTGACTCAAGTGAAGCCGATGTGTGGATCCCTGAACCTTTCCATGCTGAAGTTCCTGCAGATTGGTGGGATAAGGAAGCAGACAAATCCCTCTTAATTGGAGTGTTCAAACATGGCTATGAGAAGTACAACTCCATGCGAGCTGACCCCGCGCTGTGCTTTCTGGAACGAGTCGGTATGCCTGATGCCAAGGCCATAGCTGCCGAGCAAAGAGGAACAGACATGCTAGCAGATGGTGGTGACGGGGGAGAATTTGATAGAGAAGATGAAGACCCAGAATATAAACCAACCAGAACACCGTTCAAAGATGAAATAGATGAATTTGCAAATTCTCCTTCAGAGGATAAGGAAGAATCCATGGAAATACATGCCACAGGTAAGCACA

Numéro d'accès Ensembl | humain

ENSG00000171316

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CHD7(55636) , CHD7(55636)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nathaniel H Boyd et al.
Stem cells (Dayton, Ohio), 37(4), 453-462 (2019-01-11)
Tumorigenic and non-neoplastic tissue injury occurs via the ischemic microenvironment defined by low oxygen, pH, and nutrients due to blood supply malfunction. Ischemic conditions exist within regions of pseudopalisading necrosis, a pathological hallmark of glioblastoma (GBM), the most common primary
Yi Chen et al.
Biochemical and biophysical research communications, 478(4), 1588-1593 (2016-09-03)
Mesenchymal stem cells (MSCs) have great therapeutic potential due to their abilities to self-renewal and their potential for differentiating into a variety of cell lineages. However, how to improve the differentiation efficiency of MSC into osteoblast remains a big challenge

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique