Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU039481

Sigma-Aldrich

MISSION® esiRNA

targeting human CLTC

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGATCAGGGACAGCAGTTTGCCCAAATGTTAGTTCAAGATGAAGAGCCTCTTGCTGACATCACACAGATTGTAGATGTCTTTATGGAATACAATCTAATTCAGCAGTGTACTGCATTCTTGCTTGATGCTCTGAAGAATAATCGCCCATCTGAAGGTCCTTTACAGACGCGGTTACTTGAGATGAACCTTATGCATGCGCCTCAAGTTGCAGATGCTATTCTAGGCAATCAGATGTTCACACATTATGACCGGGCTCATATTGCTCAACTGTGTGAAAAGGCTGGCCTACTGCAGCGTGCATTAGAACATTTCACTGATTTATATGATATAAAACGTGCAGTGGTTCACACCCATCTTCTTAACCCTGAGTGGTTAGTCAACTACTTTGGTTCCTTATCAGTAGAAGACTCCCTAGAATGTCTCAGAGCCATGCTGTCTGCCAACATCCGTCAGAATCTGCAGA

Numéro d'accès Ensembl | humain

ENSG00000141367

Numéro d'accès NCBI

NM_004859

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CLTC(1213) , CLTC(1213)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Min Feng et al.
Virus research, 253, 12-19 (2018-05-29)
Bombyx mori nucleopolyhedrovirus (BmNPV) is a leading cause of silkworm mortality and economic loss to sericulture. The entry of BmNPV budded virus (BV) into host cells is a fundamental process required for the initiation of infection. However, our understanding of
Jiao Liu et al.
Science signaling, 12(585) (2019-06-13)
Transient receptor potential vanilloid 1 (TRPV1), a nonselective, ligand-gated cation channel, responds to multiple noxious stimuli and is targeted by many kinases that influence its trafficking and activity. Studies on the internalization of TRPV1 have mainly focused on that induced
Dipannita Dutta et al.
Traffic (Copenhagen, Denmark), 16(9), 994-1009 (2015-05-20)
Clathrin-mediated endocytosis (CME) and clathrin-independent endocytosis (CIE) co-exist in most cells but little is known about their communication and coordination. Here we show that when CME was inhibited, endocytosis by CIE continued but endosomal trafficking of CIE cargo proteins was
Ruobo Zhou et al.
Science (New York, N.Y.), 365(6456), 929-934 (2019-08-31)
Actin, spectrin, and related molecules form a membrane-associated periodic skeleton (MPS) in neurons. The function of the MPS, however, remains poorly understood. Using super-resolution imaging, we observed that G protein-coupled receptors (GPCRs), cell adhesion molecules (CAMs), receptor tyrosine kinases (RTKs)
Annalisa Natalicchio et al.
Diabetologia, 58(6), 1260-1271 (2015-03-27)
The role of the redox adaptor protein p66(Shc) as a potential mediator of saturated fatty acid (FA)-induced beta cell death was investigated. The effects of the FA palmitate on p66(Shc) expression were evaluated in human and murine islets and in
Afficher tous les articles scientifiques apparentés

Protocoles

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique