Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU038231

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFAIP6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCTAAGGCGGTGTGTGAATTTGAAGGCGGCCATCTCGCAACTTACAAGCAGCTAGAGGCAGCCAGAAAAATTGGATTTCATGTCTGTGCTGCTGGATGGATGGCTAAGGGCAGAGTTGGATACCCCATTGTGAAGCCAGGGCCCAACTGTGGATTTGGAAAAACTGGCATTATTGATTATGGAATCCGTCTCAATAGGAGTGAAAGATGGGATGCCTATTGCTACAACCCACACGCAAAGGAGTGTGGTGGCGTCTTTACAGATCCAAAGCAAATTTTTAAATCTCCAGGCTTCCCAAATGAGTACGAAGATAACCAAATCTGCTACTGGCACATTAGACTCAAGTATGGTCAGCGTATTCACCTGAGTTTTTTAGATTTTGACCTTGAAGATGACCCAGGTTGCTTG

Numéro d'accès Ensembl | humain

ENSG00000123610

Numéro d'accès NCBI

NM_007115

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TNFAIP6(7130) , TNFAIP6(7130)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tae-Hoon Shin et al.
Cell death & disease, 7(12), e2524-e2524 (2016-12-23)
Rheumatoid arthritis (RA) is a long-lasting intractable autoimmune disorder, which has become a substantial public health problem. Despite widespread use of biologic drugs, there have been uncertainties in efficacy and long-term safety. Mesenchymal stem cells (MSCs) have been suggested as
Guohu Di et al.
Investigative ophthalmology & visual science, 58(10), 4344–4354-4344–4354 (2017-08-16)
To explore the role and mechanism of bone marrow-derived mesenchymal stem cells (BM-MSCs) in corneal epithelial wound healing in type 1 diabetic mice. Diabetic mice were treated with subconjunctival injections of BM-MSCs or recombinant tumor necrosis factor-α-stimulated gene/protein-6 (TSG-6). The
Young In Yun et al.
Cytotherapy, 19(1), 28-35 (2016-11-15)
Mesenchymal stromal cells (MSCs) offer tremendous potential for therapeutic applications for inflammatory diseases. However, tissue-derived MSCs, such as bone marrow-derived MSCs (BM-MSCs), have considerable donor variations and limited expandability. It was recently demonstrated that MSCs derived from induced pluripotent stem
Hyun Beom Song et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 26(1), 162-172 (2018-01-05)
The cornea is a transparent tissue devoid of blood and lymphatic vessels. However, various inflammatory conditions can cause hemangiogenesis and lymphangiogenesis in the cornea, compromising transparency and visual acuity. Mesenchymal stem/stromal cells (MSCs) have therapeutic potentials in a variety of
Shengchao Zhang et al.
Stem cell research & therapy, 12(1), 50-50 (2021-01-11)
Muscle stem cells (MuSCs) are absolutely required for the formation, repair, and regeneration of skeletal muscle tissue. Increasing evidence demonstrated that tissue stem cells, especially mesenchymal stem cells (MSCs), can exert therapeutic effects on various degenerative and inflammatory disorders based
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique