Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU025841

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGAATCCGCATGACTCATAATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCCAATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATCCGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACA

Numéro d'accès Ensembl | humain

ENSG00000116478

Numéro d'accès NCBI

NM_004964

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... HDAC1(3065) , HDAC1(3065)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yutao Yang et al.
Molecular neurobiology, 53(2), 1266-1278 (2015-04-16)
POK erythroid myeloid ontogenic factor (Pokemon), an important proto-oncoprotein, is a transcriptional repressor that regulates the expression of many genes and plays an important role in tumorigenesis. Resveratrol (RSV), a natural polyphenolic compound, has many beneficial biological effects on health.
Shiladitya Sengupta et al.
Oncotarget, 7(46), 75197-75209 (2016-09-23)
Apurinic/apyrimidinic (AP) sites are frequently generated in the genome by spontaneous depurination/depyrimidination or after removal of oxidized/modified bases by DNA glycosylases during the base excision repair (BER) pathway. Unrepaired AP sites are mutagenic and block DNA replication and transcription. The
Xiaohua Yan et al.
Journal of molecular cell biology, 10(1), 48-59 (2017-10-17)
Evading TGF-β-mediated growth inhibition is often associated with tumorigenesis in liver, including hepatocellular carcinoma (HCC). To better understand the functions and the underlying molecular mechanisms of TGF-β in HCC initiation and progression, we carried out transcriptome sequencing (RNA-Seq) to identify
Baojie Zhang et al.
Cancers, 11(5) (2019-05-15)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is considered as a promising anti-cancer therapeutic. However, many cancers have been found to be or to become inherently resistant to TRAIL. A combination of epigenetic modifiers, such as histone deacetylase inhibitors (HDACi's), with
Jing Yang et al.
Scientific reports, 7, 43864-43864 (2017-03-07)
Hepatocellular carcinoma (HCC) is one of the most commonly diagnosed cancers in the world. Elevated glucose metabolism in the availability of oxygen, a phenomenon called the Warburg effect, is important for cancer cell growth. Fructose-1,6-bisphosphatase (FBP1) is a rate-limiting enzyme
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique