Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU025001

Sigma-Aldrich

MISSION® esiRNA

targeting human CMKLR1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACTTATCCCCCTTGGAAGCCAGGGTGACCAGGATCTTCCTGGTGGTGGTCTACAGCATCGTCTGCTTCCTCGGGATTCTGGGCAATGGTCTGGTGATCATCATTGCCACCTTCAAGATGAAGAAGACAGTGAACATGGTCTGGTTCCTCAACCTGGCAGTGGCAGATTTCCTGTTCAACGTCTTCCTCCCAATCCATATCACCTATGCCGCCATGGACTACCACTGGGTTTTCGGGACAGCCATGTGCAAGATCAGCAACTTCCTTCTCATCCACAACATGTTCACCAGCGTCTTCCTGCTGACCATCATCAGCTCTGACCGCTGCATCTCTGTGCTCCTCCCTGTCTGGTCCCAGAACCACCGCAGCGTTCGCCTGGCTTACATGGCCTGCATGGTCATCTGGGTCCTGGCTTTCTT

Numéro d'accès Ensembl | humain

ENSG00000174600

Numéro d'accès NCBI

NM_004072

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CMKLR1(1240) , CMKLR1(1240)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yuan Wang et al.
Journal of cellular biochemistry, 120(4), 6459-6470 (2018-11-15)
Psoriasis is a chronic disease which carries the emotional and social burden, promotes joint disability and raises comorbidity possibility in patients. Obesity is closely correlated with the occurrence of psoriasis and adipokines produced by adipose tissues were found to be
Yixin Zhang et al.
Brain, behavior, and immunity, 70, 179-193 (2018-03-03)
Chemerin, an adipokine, has been reported to reduce the production of pro-inflammatory cytokines and neutrophil infiltration. This study investigated the role of Chemerin and its natural receptor, ChemR23, as well as its downstream mediator calmodulin-dependent protein kinase kinase 2 (CAMKK2)/adenosine
Yixin Zhang et al.
Cell death & disease, 10(2), 97-97 (2019-02-06)
Hypoxic-ischemic encephalopathy (HIE) is a devastating neurological event that contributes to the prolonged neurodevelopmental consequences in infants. Therapeutic strategies focused on attenuating neuronal apoptosis in the penumbra appears to be promising. Given the increasingly recognized neuroprotective roles of adipokines in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique