Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU023131

Sigma-Aldrich

MISSION® esiRNA

targeting human LAMC2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTCAGCTGTCCAGCTTGCTATAATCAAGTGAAGATTCAGATGGATCAGTTTATGCAGCAGCTTCAGAGAATGGAGGCCCTGATTTCAAAGGCTCAGGGTGGTGATGGAGTAGTACCTGATACAGAGCTGGAAGGCAGGATGCAGCAGGCTGAGCAGGCCCTTCAGGACATTCTGAGAGATGCCCAGATTTCAGAAGGTGCTAGCAGATCCCTTGGTCTCCAGTTGGCCAAGGTGAGGAGCCAAGAGAACAGCTACCAGAGCCGCCTGGATGACCTCAAGATGACTGTGGAAAGAGTTCGGGCTCTGGGAAGTCAGTACCAGAACCGAGTTCGGGATACTCACAGGCTCATCACTCAGATGCAGCTGAGCCTGGCAGAAAGTGAAGCTTCCTTGGGAAACACTAACATTCCTGCCTCAGACCACTACGTGGGGCCAAATGGCTTTAAAAGTCTGGCTCAGGAGGCCACAAGATTAGCAGAAAGCCACGTTGAGTCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qiang-Hua Zhou et al.
Cancer management and research, 10, 2983-2995 (2018-09-15)
Molecular biomarkers, especially serologic factors, have been widely applied in cancer diagnosis and patient follow-up. However, there are few valuable prognostic factors in penile squamous cell carcinoma (PSCC). Here, the authors investigated whether laminin gamma 2 (LAMC2) expression, especially serum
Yan Liang et al.
Cell death and differentiation, 25(11), 1980-1995 (2018-03-08)
Esophageal squamous cell carcinoma (ESCC) is the main subtype of esophageal cancer. Long noncoding RNAs (lncRNAs) are thought to play a critical role in cancer development. Recently, lncRNA CASC9 was shown to be dysregulated in many cancer types, but the
Yao-Fei Pei et al.
The American journal of pathology, 189(8), 1637-1653 (2019-07-28)
Cholangiocarcinoma (CCA) is a malignant cancer that is associated with high mortality rates. The relationship between laminin γ 2 chain gene (LAMC2) and epidermal growth factor receptor (EGFR) has been previously documented in gastric cancer and oral squamous cell carcinoma.
Manoj Garg et al.
Scientific reports, 7(1), 9749-9749 (2017-08-31)
Anaplastic thyroid carcinoma (ATC) is one of the most lethal malignancies having no effective treatment. Exportin-1 (XPO1) is the key mediator of nuclear export of many tumor suppressor proteins and is overexpressed in human cancers. In this study, we examined
D O Velez et al.
Nature communications, 8(1), 1651-1651 (2017-11-23)
The topographical organization of collagen within the tumor microenvironment has been implicated in modulating cancer cell migration and independently predicts progression to metastasis. Here, we show that collagen matrices with small pores and short fibers, but not Matrigel, trigger a

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique