Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU022711

Sigma-Aldrich

MISSION® esiRNA

targeting human PRICKLE1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAAAGCCTCTTTCAGCCACAGCCCAATGAGATGGATATTCGAGCCAGTGAGCACTGGATATCTGATAACATGGTTAAAAGTAAGACCGAGTTAAAGCAAAATAACCAGAGCCTTGCAAGTAAAAAATACCAGTCTGATATGTACTGGGCACAGTCACAAGATGGACTGGGCGATTCTGCTTATGGCAGCCACCCAGGCCCTGCAAGCAGTAGAAGGCTTCAGGAATTGGAACTGGACCATGGGGCTTCAGGGTATAATCATGATGAAACACAGTGGTATGAAGATTCCCTGGAGTGTCTGTCAGACCTGAAACCAGAGCAAAGTGTTCGGGATTCGATGGATTCTTTGGCATTGTCCAATATCACAGGGGCTTCGGTGGATGGAGAAAACAAGCCAAGGCCATCATTGTATTCTCTGCAAAATTTTGAGGAGATGGAAACAGAAGATTGTGAGAAGATGAGCAATATGGGAACTTTGAACTCTTCCATGCTGCAC

Numéro d'accès Ensembl | humain

ENSG00000139174

Numéro d'accès NCBI

NM_153026

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PRICKLE1(144165) , PRICKLE1(144165)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
SUS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Danielle E Johnson et al.
The Journal of cell biology, 212(6), 677-692 (2016-03-16)
We examined the luminal pH of individual lysosomes using quantitative ratiometric fluorescence microscopy and report an unappreciated heterogeneity: peripheral lysosomes are less acidic than juxtanuclear ones despite their comparable buffering capacity. An increased passive (leak) permeability to protons, together with
Adi Efergan et al.
Journal of immunology (Baltimore, Md. : 1950), 196(3), 1091-1101 (2016-01-08)
Secretory granule (SG) transport is a critical step in regulated exocytosis including degranulation of activated mast cells. The latter process results in the release of multiple inflammatory mediators that play key roles in innate immunity, as well as in allergic
Noopur V Khobrekar et al.
Developmental cell, 53(2), 141-153 (2020-04-11)
Autophagy plays critical roles in neurodegeneration and development, but how this pathway is organized and regulated in neurons remains poorly understood. Here, we find that the dynein adaptor RILP is essential for retrograde transport of neuronal autophagosomes, and surprisingly, their

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique