Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU022031

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGCCAAAGCCACTATCCTGTGGGACAATGCCTTCTCTGAGATGGACCGCGTGCCCTTTGTGGTGGCTGAGCGGGTGCCCTGGGAGAAGATGTGTGAAACTCTGAACCTGAAGTTCATGGCTGAGGTGGGGACCAACCGGGGGCTGCTCCCAGAGCACTTCCTCTTCCTGGCCCAGAAGATCTTCAATGACAACAGCCTCAGTATGGAGGCCTTCCAGCACCGTTCTGTGTCCTGGTCGCAGTTCAACAAGGAGATCCTGCTGGGCCGTGGCTTCACCTTTTGGCAGTGGTTTGATGGTGTCCTGGACCTCACCAAACGCTGTCTCCGGAGCTACTGGTCTGACCGGCTGATCATTGGCTTCATCAGCAAACAGTACGTTACTAGCCTTCTTCTCAATGAGCCCGACGGAACCTTTCTCCTCCGCTTCAGCGACTCAGAGATTGGGGGCATCACCATTGCCCATGTCATCCGGGGCCAGGATGGCTCTCCACAGAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tian Qing et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 1-6 (2017-05-20)
Signal transducer and activator of transcription-6 (STAT6) is highly expressed in various human cancers and considered a regulator of multiple biological processes in cancers, including cell apoptosis. Evidence has indicated that STAT6 predicts a worse prognosis in hepatocellular carcinoma (HCC)
Zachary P McKay et al.
Journal of immunology (Baltimore, Md. : 1950), 206(6), 1385-1394 (2021-01-29)
Crosstalk between costimulatory and coinhibitory ligands are a prominent node of immune cell regulation. Mounting evidence points toward a critical role for CD155, the poliovirus receptor, in suppressing T cell function, particularly in cancer. However, relative to other known costimulatory/coinhibitory
Li Yang et al.
Cellular & molecular immunology, 13(5), 669-677 (2015-07-21)
The etiology and the underlying mechanism of CD4(+) T-cell polarization are unclear. This study sought to investigate the mechanism by which interleukin (IL)-13 prevents the activation-induced apoptosis of CD4(+) T cells. Here we report that CD4(+) T cells expressed IL-13
Kristine C Olson et al.
Cytokine, 111, 551-562 (2018-11-21)
Calcitriol, the active form of vitamin D, has been well documented to act directly on immune cells and malignant cells. Activated T cells are one of the best characterized targets of calcitriol, with effects including decreasing inflammatory cytokine output and
Noelia Keiran et al.
Nature immunology, 20(5), 581-592 (2019-04-10)
Succinate is a signaling metabolite sensed extracellularly by succinate receptor 1 (SUNCR1). The accumulation of succinate in macrophages is known to activate a pro-inflammatory program; however, the contribution of SUCNR1 to macrophage phenotype and function has remained unclear. Here we

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique