Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU018301

Sigma-Aldrich

MISSION® esiRNA

targeting human PPARGC1A (2)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCAAGTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAGCCTTCAAACATATTTGAGAAGATAGATGAAGAGAATGAGGCAAACTTGCTAGCAGTCCTCACAGAGACACTAGACAGTCTCCCTGTGGATGAAGACGGATTGCCCTCATTTGATGCGCTGACAGATGGAGACGTGACCACTGACAATGAGGCTAGTCCTTCCTCCATGCCTGACGGCACCCCTCCACCCCAGGAGGCAGAAGAGCCGTCTCTACTTAAGAAGCTCTTACTGGCACCAGCCAACACTCAGCTA

Numéro d'accès Ensembl | humain

ENSG00000109819

Numéro d'accès NCBI

NM_013261

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PPARGC1A(10891) , PPARGC1A(10891)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Actions biochimiques/physiologiques

PPARGC1A (peroxisome proliferator-activated receptor γ coactivator 1-α) is a transcriptional regulator which plays a key role in insulin signaling and mitochondrial regulation. It controls metabolism in many organs. For instance, it regulates gluconeogenesis in hepatocytes, thermogenesis in brown adipose tissue, and mitochondrial biogenesis and fatty acid oxidation in the heart. PPARGC1A also attenuates oxidative damage. Mutations in this gene are associated with type 2 diabetes mellitus. It is downregulated in prostate cancer. Presence of PPARGC1A inhibits prostate cancer progression and metastasis. However, presence of this protein gives selective advantages in breast cancer and melanoma cells.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiao-Xia Zhang et al.
Cell biochemistry and function, 38(5), 549-557 (2020-02-11)
Neuregulin-1 (NRG-1)/erythroblastic leukaemia viral oncogene homologues (ErbB) pathway activation plays a crucial role in regulating the adaptation of the adult heart to physiological and pathological stress. In the present study, we investigate the effect of recombined human NRG-1 (rhNRG-1) on
PGC-1a, glucose metabolism and type 2 diabetes mellitus.
Wu H
The Journal of Endocrinology, 229, R99-R99 (2016)
Lack of direct evidence for natural selection at the candidate thrifty gene locus, PPARGC1A.
Cadzow M
BMC Medical Genetics, 17, 80-80 (2016)
Suppression of endothelial PGC-1a is associated with hypoxia-induced endothelial dysfunction and provides a new therapeutic target in pulmonary arterial hypertension.
Ye JX
American Journal of Physiology. Lung Cellular and Molecular Physiology, 310, L1233-L1233 (2016)
The metabolic co-regulator PGC1a suppresses prostate cancer metastasis.
Torrano V, et. al.
Nature Cell Biology, 18, 645-645 (2016)
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique