Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU014941

Sigma-Aldrich

MISSION® esiRNA

targeting human ABL2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGCGTCTGGAAGAAATACAGCCTTACAGTTGCTGTGAAAACATTGAAGGAAGATACCATGGAGGTAGAAGAATTCCTGAAAGAAGCTGCAGTAATGAAGGAAATCAAGCATCCTAATCTGGTACAACTTTTAGGTGTGTGTACTTTGGAGCCACCATTTTACATTGTGACTGAATACATGCCATACGGGAATTTGCTGGATTACCTCCGAGAATGCAACCGAGAAGAGGTGACTGCAGTTGTGCTGCTCTACATGGCCACTCAGATTTCTTCTGCAATGGAGTACTTAGAGAAGAAGAATTTCATCCATAGAGATCTTGCAGCTCGTAACTGCCTAGTGGGAGAAAACCATGTGGTAAAAGTGGCTGACTTTGGCTTAAGTAGATTGATGACTGGAGACACTTATACTGCTCATGCTGGAGCCAAATTTCCTATTAAGTGGACAGCACCAGAGAGTCTTGCCTACAATACCTTCTCAATTAAATCTGACGTCTGGGCTTTTGGGGTATT

Numéro d'accès Ensembl | humain

ENSG00000143322

Numéro d'accès NCBI

NM_007314

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ABL2(27) , ABL2(27)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

H Gil-Henn et al.
Oncogene, 32(21), 2622-2630 (2012-07-11)
Tumor progression is a complex, multistep process involving accumulation of genetic aberrations and alterations in gene expression patterns leading to uncontrolled cell division, invasion into surrounding tissue and finally dissemination and metastasis. We have previously shown that the Arg/Abl2 non-receptor
Xiu-Fen Ming et al.
Journal of the American Heart Association, 1(4), e000992-e000992 (2012-11-07)
Macrophage-mediated chronic inflammation is mechanistically linked to insulin resistance and atherosclerosis. Although arginase I is considered antiinflammatory, the role of arginase II (Arg-II) in macrophage function remains elusive. This study characterizes the role of Arg-II in macrophage inflammatory responses and
Takafumi Ichikawa et al.
Journal of cell science, 130(20), 3517-3531 (2017-09-03)
Vinexin, c-Cbl associated protein (CAP) and Arg-binding protein 2 (ArgBP2) constitute an adaptor protein family called the vinexin (SORBS) family that is targeted to focal adhesions (FAs). Although numerous studies have focused on each of the SORBS proteins and partially
Alicia N Rizzo et al.
Vascular pharmacology, 128-129, 106677-106677 (2020-04-03)
Acute Respiratory Distress Syndrome (ARDS) is a devastating disease process that involves dysregulated inflammation and decreased alveolar-capillary barrier function. Despite increased understanding of the pathophysiology, no effective targeted therapies exist to treat ARDS. Recent preclinical studies suggest that the multi-tyrosine
Ewelina Testoni et al.
EMBO molecular medicine, 8(2), 105-116 (2016-01-14)
The lack of actionable mutations in patients with non-small cell lung cancer (NSCLC) presents a significant hurdle in the design of targeted therapies for this disease. Here, we identify somatically mutated ABL1 as a genetic dependency that is required to
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique