Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU013431

Sigma-Aldrich

MISSION® esiRNA

targeting human RAD18

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGCAGGGGAGCAGGTTAATGGATAATTTCTTGATCAGAGAAATGAGTGGTTCTACATCAGAGTTGTTGATAAAAGAAAATAAAAGCAAATTCAGCCCTCAAAAAGAGGCGAGCCCTGCTGCAAAGACCAAAGAGACACGTTCTGTAGAAGAGATCGCTCCAGATCCCTCAGAGGCTAAGCGTCCTGAGCCACCCTCGACATCCACTTTGAAACAAGTTACTAAAGTGGATTGTCCTGTTTGCGGGGTTAACATTCCAGAAAGTCACATTAATAAGCATTTAGACAGCTGTTTATCACGCGAAGAGAAGAAGGAAAGCCTCAGAAGTTCTGTTCACAAAAGGAAGCCGCTGCCCAAAACTGTATATAATTTGCTCTCTGATCGTGATTTAAAGAAAAAGCTAAAAGAGCATGGATTATCTATTCAAGGAAATAAACAACAGCTCATTAAAAGGCACCAAGAATTTGTACACATGTACAATGCCCAATGCGATGCTTTGCATCCTAAATCAGCTGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chen Xie et al.
Journal of cellular physiology, 234(11), 21100-21112 (2019-05-14)
This study aimed at investigating the role of RAD18 in the regulation of glioblastoma development as well as the underlying mechanisms. The human glioblastoma U251 and U87MG cells were transfected with siRNAs specifically targeting RAD18, and the effects of knockdown
Megumi Sasatani et al.
PloS one, 10(2), e0117845-e0117845 (2015-02-13)
The ubiquitin ligase RAD18 is involved in post replication repair pathways via its recruitment to stalled replication forks, and its role in the ubiquitylation of proliferating cell nuclear antigen (PCNA). Recently, it has been reported that RAD18 is also recruited
Thomas Göhler et al.
The Journal of cell biology, 192(2), 219-227 (2011-01-19)
DNA polymerase η (polη) belongs to the Y-family of DNA polymerases and facilitates translesion synthesis past UV damage. We show that, after UV irradiation, polη becomes phosphorylated at Ser601 by the ataxia-telangiectasia mutated and Rad3-related (ATR) kinase. DNA damage-induced phosphorylation
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique