Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU012621

Sigma-Aldrich

MISSION® esiRNA

targeting human POLD3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTTGGTGTCTGGCAGTCTCATTCAGAATGGACATTCCTGCCACAAGGTTGCAGTAGTGAGAGAAGATAAATTGGAAGCAGTGAAGTCCAAGCTAGCTGTGACTGCCAGCATCCATGTGTACAGCATCCAGAAAGCCATGCTAAAGGACAGTGGGCCTCTGTTCAATACTGACTATGACATCCTTAAAAGCAACTTGCAGAACTGCAGCAAATTTAGTGCTATACAATGTGCAGCTGCCGTCCCTAGAGCTCCTGCTGAATCCTCTTCGTCTTCCAAAAAGTTTGAGCAGTCACATCTTCACATGTCAAGTGAGACACAAGCCAACAATGAGCTGACCACCAATGGTCATGGCCCACCTGCATCCAAGCAGGTTTCCCAGCAGCCCAAAGGAATTATGGGAATGTTTGCCTCCAAAGCTGCTGCTAAAACC

Numéro d'accès Ensembl | humain

ENSG00000077514

Numéro d'accès NCBI

NM_006591

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... POLD3(10714) , POLD3(10714)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Emanuela Tumini et al.
Scientific reports, 6, 38873-38873 (2016-12-16)
DNA replication is essential for cellular proliferation. If improperly controlled it can constitute a major source of genome instability, frequently associated with cancer and aging. POLD1 is the catalytic subunit and POLD3 is an accessory subunit of the replicative Pol
Xianning Lai et al.
Nature communications, 8, 15983-15983 (2017-07-18)
Failure to restart replication forks stalled at genomic regions that are difficult to replicate or contain endogenous DNA lesions is a hallmark of BRCA2 deficiency. The nucleolytic activity of MUS81 endonuclease is required for replication fork restart under replication stress
Robert L Dilley et al.
Nature, 539(7627), 54-58 (2016-11-04)
Homology-directed DNA repair is essential for genome maintenance through templated DNA synthesis. Alternative lengthening of telomeres (ALT) necessitates homology-directed DNA repair to maintain telomeres in about 10-15% of human cancers. How DNA damage induces assembly and execution of a DNA
Sheroy Minocherhomji et al.
Nature, 528(7581), 286-290 (2015-12-04)
Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique