Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU012341

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTCCAAGGTGGAAGTGGTAGCCTCCCTGAAGAACGGGAAGGAAATTTGTCTTGATCCAGAAGCCCCTTTTCTAAAGAAAGTCATCCAGAAAATTTTGGACGGTGGAAACAAGGAAAACTGATTAAGAGAAATGAGCACGCATGGAAAAGTTTCCCAGTCTTCAGCAGAGAAGTTTTCTGGAGGTCTCTGAACCCAGGGAAGACAAGAAGGAAAGATTTTGTTGTTGTTTGTTTATTTGTTTTTCCAGTAGTTAGCTTTCTTCCTGGATTCCTCACTTTGAAGAGTGTGAGGAAAACCTATGTTTGCCGCTTAAGCTTTCAGCTCAGCTAATGAAGTGTTTAGCATAGTACCTCTGCTATTTGCTGTTATTTTATCTGCTATGCTATTGAAGTTTTGGCAATTGACTATAGTGTGAGCCAGGAATCACTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhijie Dai et al.
Oncology reports, 36(6), 3303-3310 (2016-10-18)
CXCL5 and its receptor CXCR2 have been found to be involved in tumorigenesis and cancer progression. Recent studies have shown that CXCR2 is upregulated in glioma tissues, and associated with poor prognosis and recurrence. However, the role of CXCL5/CXCR2 signaling in
Hongsheng Dang et al.
Oncology research, 25(2), 177-186 (2017-03-10)
CXCL5, a CXC-type chemokine, is an important attractant for granulocytic immune cells by binding to its receptor CXCR2. Recently, CXCL5/CXCR2 has been found to play an oncogenic role in many human cancers. However, the exact role of CXCL5 in osteosarcoma
Toshiyuki Mitsuyama et al.
Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.], 15(3), 271-280 (2015-03-31)
Characteristics of type 2 autoimmune pancreatitis (AIP) is granulocyte epithelial lesions, called idiopathic duct-centric pancreatitis (IDCP). To clarify pathogenesis of IDCP, we investigated mechanism of neutrophil infiltration in type 1 AIP, called lymphoplasmacytic sclerosing pancreatitis (LPSP) and IDCP. This study

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique