Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

Autres documents

EHU007771

Sigma-Aldrich

MISSION® esiRNA

targeting human IKBKB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAAGAATTCCATGGCTTCCATGTCTCAGCAGCTCAAGGCCAAGTTGGATTTCTTCAAAACCAGCATCCAGATTGACCTGGAGAAGTACAGCGAGCAAACCGAGTTTGGGATCACATCAGATAAACTGCTGCTGGCCTGGAGGGAAATGGAGCAGGCTGTGGAGCTCTGTGGGCGGGAGAACGAAGTGAAACTCCTGGTAGAACGGATGATGGCTCTGCAGACCGACATTGTGGACTTACAGAGGAGCCCCATGGGCCGGAAGCAGGGGGGAACGCTGGACGACCTAGAGGAGCAAGCAAGGGAGCTGTACAGGAGACTAAGGGAAAAACCTCGAGACCAGCGAACTGAGGGTGACAGTCAGGAAATGGTACGGCTGCTGCTTCAGGCAATTCAGAGCTTCGAGAAGAAAGTGCGAGTGATCTATACGCAGCTCAGTAAAACTGTGGTTTGCAAGCAGAAGGCGCTGGAACTGTTGCCCAAGGTGGAAGAGGTGGTGAGCTTAATGAATGAGGATGAGAAGACTGTTGTCCGGCTG

Numéro d'accès Ensembl | humain

ENSG00000104365

Numéro d'accès NCBI

NM_001556

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IKBKB(3551) , IKBKB(3551)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hae-Ki Min et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 30(12), 4071-4082 (2016-08-25)
IGF-binding protein-3 (IGFBP-3) is a liver-derived, anti-inflammatory molecule that is decreased in obesity, a key risk factor for nonalcoholic fatty liver disease (NAFLD). It was not known whether IGFBP-3 levels were altered in NAFLD, whether such alterations could be the
Peter O Oladimeji et al.
Biochemical pharmacology, 160, 92-109 (2018-12-20)
The pregnane X receptor (PXR) is a principal xenobiotic receptor crucial in the detection, detoxification, and clearance of toxic substances from the body. PXR plays a vital role in the metabolism and disposition of drugs, and elevated PXR levels contribute to cancer

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique