Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU007051

Sigma-Aldrich

MISSION® esiRNA

targeting human S100B

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGACCAGGAAGGGGTGAGACAAGGAAGAGGATGTCTGAGCTGGAGAAGGCCATGGTGGCCCTCATCGACGTTTTCCACCAATATTCTGGAAGGGAGGGAGACAAGCACAAGCTGAAGAAATCCGAACTGAAGGAGCTCATCAACAATGAGCTTTCCCATTTCTTAGAGGAAATCAAAGAGCAGGAGGTTGTGGACAAAGTCATGGAAACACTGGACAATGATGGAGACGGCGAATGTGACTTCCAGGAATTCATGGCCTTTGTTGCCATGGTTACTACTGCCTGCCACGAGTTCTTTGAACATGAGTGAGATTAGAAAGCAGCCAAACCTTTCCTGTAACAGAGACGGTCATGCAAGAAAGCAGACAGCAAGGGCTTGCAGCCTAGTAGGAGCTGAGCTTTCCAGCCGTGTTGTAGCTAATTAGGAAGCTTGATTTGCTTTGTGATTGAAAAATTGAAAACCTCTTTCCAAAGGCTGTTTTAACGGCCTGCATCATTCTTTCTGCTATATTAGGCCTGTGTGTAAGCTGACTGGCC

Numéro d'accès Ensembl | humain

ENSG00000160307

Numéro d'accès NCBI

NM_006272

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... S100B(6285) , S100B(6285)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Teng Cao et al.
Biochimica et biophysica acta, 1863(11), 2772-2782 (2017-07-12)
S100B is a biomarker of nervous system injury, but it is unknown if it is also involved in vascular injury. In the present study, we investigated S100B function in vascular remodeling following injury. Balloon injury in rat carotid artery progressively
Giulio Morozzi et al.
Cell death and differentiation, 24(12), 2077-2088 (2017-09-09)
Muscles of sarcopenic people show hypotrophic myofibers and infiltration with adipose and, at later stages, fibrotic tissue. The origin of infiltrating adipocytes resides in fibro-adipogenic precursors and nonmyogenic mesenchymal progenitor cells, and in satellite cells, the adult stem cells of
Jin-Hua Zhang et al.
Journal of cellular biochemistry, 119(10), 8095-8111 (2018-02-01)
Ischemic stroke is the leading cause of worldwide mortality and long-term disability in adults. This study aims to explore the effects of RNA interference (RNAi)-mediated silencing of the S100B gene on nerve function recovery and morphological changes of hippocampus cells

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique