Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU003451

Sigma-Aldrich

MISSION® esiRNA

targeting human POLR2A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGGCAAGCAAATCTTCTCCCTCATCATACCTGGTCACATCAATTGTATCCGTACCCACAGTACCCATCCCGATGATGAAGACAGTGGCCCTTACAAGCACATCTCTCCTGGGGACACCAAGGTGGTGGTGGAGAATGGGGAGCTGATCATGGGCATCCTGTGTAAGAAGTCTCTGGGCACGTCAGCTGGCTCCCTGGTCCACATCTCCTACCTAGAGATGGGTCATGACATCACTCGCCTCTTCTACTCCAACATTCAGACTGTCATTAACAACTGGCTCCTCATCGAGGGTCATACTATTGGCATTGGGGACTCCATTGCTGATTCTAAGACTTACCAGGACATTCAGAACACTATTAAGAAGGCCAAGCAGGACGTAATAGAGGTCATCGAGAAGGCACACAACAATGAGCTGGAGCCCACCCCAGGGAACACTCTGCGGCAGACGTTTGAGAATCAGGTGAACCGCATTCTTAACGATGCCCGAGACAAGACTGGCTCCTCTGCTCAGAAATCCCTGTCTGAATACAATAACTTCAAGTCTATGGTCGTGTCCGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jiangsheng Xu et al.
Nature nanotechnology, 14(4), 388-397 (2019-02-26)
TP53 is the most frequently mutated or deleted gene in triple negative breast cancer (TNBC). Both the loss of TP53 and the lack of targeted therapy are significantly correlated with poor clinical outcomes, making TNBC the only type of breast
Kelly Brooks et al.
Pigment cell & melanoma research, 27(5), 813-821 (2014-06-04)
Melanoma cell lines are commonly defective for the G2-phase cell cycle checkpoint that responds to incomplete catenation of the replicated chromosomes. Here, we demonstrate that melanomas defective for this checkpoint response are less sensitive to genotoxic stress, suggesting that the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique