Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU002981

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF3A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCTGTCAGTGTGGATGAGATGAGGGGAACTATCACTGTACATAAGACTGATTCTTCCAATGAACCTCCAAAGACATTTACTTTTGATACTGTTTTTGGACCAGAGAGTAAACAACTTGATGTTTATAACTTAACTGCAAGACCTATTATTGATTCTGTACTTGAAGGCTACAATGGGACTATTTTTGCATATGGACAAACCGGAACAGGCAAAACTTTTACCATGGAAGGTGTTCGAGCTATTCCTGAACTTAGAGGAATAATTCCCAATTCATTTGCTCACATATTTGGTCATATTGCAAAAGCGGAGGGTGATACAAGATTTTTGGTTCGAGTGTCTTATTTGGAAATATATAATGAAGAAGTTCGTGACCTTTTGGGCAAGGATCAGACACAAAGGTTAGAGGTTAAAGAAAGACCTGATGTGGGAGTTTATATCAAAGATTTATCAGCTTATGTGGTAAATAATGCTGATGATATGGATAGAATTATGACGCTAGGCCACAAAAATCGTTCTGTTGGTGCAACTAATATGAACGAACATAGTTCCCGTTCCCATG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Loren Masterson et al.
Journal of skin cancer, 2014, 596459-596459 (2014-03-19)
Due to the rarity of Merkel cell carcinoma (MCC), prospective clinical trials have not been practical. This study aimed to identify biomarkers with prognostic significance. While sixty-two patients were identified who were treated for MCC at our institution, only seventeen
Premkumar Vummidi Giridhar et al.
Journal of immunology (Baltimore, Md. : 1950), 197(11), 4228-4239 (2016-11-01)
KIF3A, the gene encoding kinesin family member 3A, is a susceptibility gene locus associated with asthma; however, mechanisms by which KIF3A might influence the pathogenesis of the disorder are unknown. In this study, we deleted the mouse Kif3a gene in
Anne-Clémence Vion et al.
The Journal of cell biology, 217(5), 1651-1665 (2018-03-04)
Blood flow shapes vascular networks by orchestrating endothelial cell behavior and function. How endothelial cells read and interpret flow-derived signals is poorly understood. Here, we show that endothelial cells in the developing mouse retina form and use luminal primary cilia
Don-Marc Franchini et al.
Cell reports, 26(1), 94-107 (2019-01-04)
Despite the clinical success of blocking inhibitory immune checkpoint receptors such as programmed cell death-1 (PD-1) in cancer, the mechanisms controlling the expression of these receptors have not been fully elucidated. Here, we identify a post-transcriptional mechanism regulating PD-1 expression

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique