Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU001891

Sigma-Aldrich

MISSION® esiRNA

targeting human INCENP

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACCTGCTGGAGCTATGTGACCAGAAGCTCATGGAGTTTCTCTGCAACATGGATAATAAGGACTTGGTGTGGCTTGAGGAAATCCAAGAGGAGGCCGAGCGCATGTTCACCAGAGAATTCAGCAAAGAGCCAGAGCTGATGCCCAAAACACCTTCTCAGAAGAACCGACGGAAGAAGAGACGGATTTCTTATGTTCAGGATGAAAACAGAGATCCCATCAGGAGAAGGTTATCCCGCAGAAAGTCTCGGAGCAGCCAGCTGAGCTCCCGACGCCTCCGCAGCAAGGACAGTGTAGAGAAGCTGGCTACAGTGGTCGGGGAGAACGGCTCCGTCCTGCGGCGTGTGACCCGTGCTGCGGCTGCAGCTGCCGCGGCTACCATGGCATTGGCTGCACCTTCTTCACCCACCCCTGAGTCTCCCACGATGCTGACTAAGAAGCCCG

Numéro d'accès Ensembl | humain

ENSG00000149503

Numéro d'accès NCBI

NM_020238

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... INCENP(3619) , INCENP(3619)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Andrius Serva et al.
PloS one, 7(12), e52555-e52555 (2013-01-04)
miRNA cluster miR-17-92 is known as oncomir-1 due to its potent oncogenic function. miR-17-92 is a polycistronic cluster that encodes 6 miRNAs, and can both facilitate and inhibit cell proliferation. Known targets of miRNAs encoded by this cluster are largely
Keith F DeLuca et al.
The Journal of cell biology, 217(1), 163-177 (2017-12-01)
Precise regulation of kinetochore-microtubule attachments is essential for successful chromosome segregation. Central to this regulation is Aurora B kinase, which phosphorylates kinetochore substrates to promote microtubule turnover. A critical target of Aurora B is the N-terminal "tail" domain of Hec1
Ming Sun et al.
Cancer research, 79(19), 4937-4950 (2019-08-17)
Chromosomal passenger complex (CPC) has been demonstrated to be a potential target of cancer therapy by inhibiting Aurora B or survivin in different types of cancer including neuroblastoma. However, chemical inhibition of either Aurora B or survivin does not target

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique