Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU001471

Sigma-Aldrich

MISSION® esiRNA

targeting human AURKB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCTTAACGCGGCACTTCACAATTGATGACTTTGAGATTGGGCGTCCTCTGGGCAAAGGCAAGTTTGGAAACGTGTACTTGGCTCGGGAGAAGAAAAGCCATTTCATCGTGGCGCTCAAGGTCCTCTTCAAGTCCCAGATAGAGAAGGAGGGCGTGGAGCATCAGCTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCACCATCCCAACATCCTGCGTCTCTACAACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTATGCCCCCCGCGGGGAGCTCTACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGAACAGCCACGATCATGGAGGAGTTGGCAGATGCTCTAATGTACTGCCATGGGAAGAAGGTGATTCACAGAGACATAAAGCCAGAAAATCTGCTCTTAGGGCTCAAGGGAGAGCTGAAGATTGCTGACTTCGGCTGGTCTGTGCATGCGCCCTCCCTGAGGAGGAAGACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAGGGGCGCATGCACAATGAGAAGGTGGATCTGTGGTGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sun Lee et al.
Pathology oncology research : POR, 26(1), 453-459 (2018-11-14)
NOP53 ribosome biogenesis factor (NOP53) is a nucleolar protein involved in oncogenesis/tumor suppression, cell cycle regulation, and cell death. Here, we investigated the role of NOP53 in the maintenance of normal nuclear shape and chromosomal stability. Depletion of NOP53 by
Kazuharu Kai et al.
Molecular cancer therapeutics, 14(12), 2687-2699 (2015-10-08)
Currently, no targeted drug is available for triple-negative breast cancer (TNBC), an aggressive breast cancer that does not express estrogen receptor, progesterone receptor, or HER2. TNBC has high mitotic activity, and, because Aurora A and B mitotic kinases drive cell
Antonio Madejón et al.
Journal of hepatology, 63(2), 312-319 (2015-03-04)
Chronic hepatitis C is a leading cause of chronic liver disease, cirrhosis and hepatocellular carcinoma. DNA methylation and histone covalent modifications constitute crucial mechanisms of genomic instability in human disease, including liver fibrosis and hepatocellular carcinoma. The present work studies
Aarthi Jayanthan et al.
Journal of pediatric hematology/oncology, 41(6), e359-e370 (2019-02-01)
Recent studies have shown that cell cycle events are tightly controlled by complex and shared activities of a select group of kinases. Among these, polo-like kinases (Plks) are regulatory mitotic proteins that are overexpressed in several types of cancer and
Zhibin Yu et al.
Journal of hematology & oncology, 10(1), 115-115 (2017-06-10)
SIX homeobox 3 (SIX3) is a member of the sine oculis homeobox transcription factor family. It plays a vital role in the nervous system development. Our previous study showed that the SIX3 gene is hypermethylated, and its expression is decreased

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique