Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

Autres documents

EHU001251

Sigma-Aldrich

MISSION® esiRNA

targeting human BTG1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCACTGGTTCCCAGAAAAGCCATGCAAGGGATCGGGTTACCGTTGTATTCGCATCAACCATAAAATGGATCCTCTGATTGGACAGGCAGCACAGCGGATTGGACTGAGCAGTCAGGAGCTGTTCAGGCTTCTCCCAAGTGAACTCACACTCTGGGTTGACCCCTATGAAGTGTCCTACAGAATTGGAGAGGATGGCTCCATCTGTGTGCTGTATGAAGCCTCACCAGCAGGAGGTAGCACTCAAAACAGCACCAACGTGCAAATGGTAGACAGCCGAATCAGCTGTAAGGAGGAACTTCTCTTGGGCAGAACGAGCCCTTCCAAAAACTACAATATGATGACTGTATCAGGTTAAGATATAGTCTGTGGATGGATCATCTGATGATGATGGATAAATTTGATTTTTGCTTTGGGTGGGCTCCTCTTGGGGATGGATTATGGA

Numéro d'accès Ensembl | humain

ENSG00000133639

Numéro d'accès NCBI

NM_001731

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... BTG1(694) , BTG1(694)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jeong Sook Kim et al.
International journal of molecular sciences, 20(13) (2019-07-22)
Estrogen affects endometrial cellular proliferation by regulating the expression of the c-myc gene. B-cell translocation gene 1 (BTG1), a translocation partner of the c-myc, is a tumor suppressor gene that promotes apoptosis and negatively regulates cellular proliferation and cell-to-cell adhesion.
Peng Yin et al.
Cancer chemotherapy and pharmacology, 81(5), 863-872 (2018-03-15)
Nasopharyngeal carcinoma (NPC) is one of the most commonly diagnosed cancers worldwide with significantly high prevalence in Southern China. Chemoprevention of cancer with alkylating agent compounds could potentially reverse, suppress, or prevent cancer progression. Cisplatin (CIS) is an antineoplastic or
Zhen-Zhen Zhang et al.
American journal of physiology. Endocrinology and metabolism, 316(6), E1050-E1060 (2019-03-06)
Diabetic retinopathy (DR) is a serious diabetic complication caused by both environmental and genetic factors. Molecular mechanisms of DR may lead to the discovery of reliable prognostic indicators. The current study aimed to clarify the mechanism of microRNA-183 (miR-183) in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique