Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU000841

Sigma-Aldrich

MISSION® esiRNA

targeting human KIT

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTACAACGATGTGGGCAAGACTTCTGCCTATTTTAACTTTGCATTTAAAGGTAACAACAAAGAGCAAATCCATCCCCACACCCTGTTCACTCCTTTGCTGATTGGTTTCGTAATCGTAGCTGGCATGATGTGCATTATTGTGATGATTCTGACCTACAAATATTTACAGAAACCCATGTATGAAGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGATCACAAATGGGAGTTTCCCAGAAACAGGCTGAGTTTTGGGAAAACCCTGGGTGCTGGAGCTTTCGGGAAGGTTGTTGAGGCAACTGCTTATGGCTTAATTAAGTCAGATGCGGCCATGACTGTCGCTGTAAAGATGCTCAAGCCGAGTGCCCATTTGACAGAACGGGAAGCCCTCATGTCTGAAC

Numéro d'accès Ensembl | humain

ENSG00000157404

Numéro d'accès NCBI

NM_000222

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KIT(3815) , KIT(3815)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sook-Kyoung Heo et al.
Scientific reports, 7(1), 15278-15278 (2017-11-12)
Dasatinib and radotinib are oral BCR-ABL tyrosine kinase inhibitors that were developed as drugs for the treatment of chronic myeloid leukemia. We report here that the c-KIT (CD117) targeting with dasatinib and radotinib promotes acute myeloid leukemia (AML) cell death
Kyung-Hwa Lee et al.
Oncotarget, 6(5), 3240-3253 (2015-01-22)
KITENIN (KAI1 COOH-terminal interacting tetraspanin) promotes tumor invasion and metastasis in various cancers. This study assessed the association between KITENIN expression and advanced glioma grade in patients. In vitro assays revealed that KITENIN knockdown inhibited the invasion and migration of
Gaurang Trivedi et al.
Science translational medicine, 11(511) (2019-09-27)
Adult stem and progenitor cells are uniquely capable of self-renewal, and targeting this process represents a potential therapeutic opportunity. The early erythroid progenitor, burst-forming unit erythroid (BFU-E), has substantial self-renewal potential and serves as a key cell type for the
Erola Ainsua-Enrich et al.
Journal of immunology (Baltimore, Md. : 1950), 194(9), 4309-4318 (2015-03-27)
SH3-binding protein 2 (3BP2) is a cytoplasmic adaptor protein that acts as a positive regulator in mast cell FcεRI-dependent signaling. The KIT receptor whose ligand is the stem cell factor is necessary for mast cell development, proliferation, and survival as
Yanli Jin et al.
Cancer letters, 353(1), 115-123 (2014-08-05)
Gain-of-function mutations of receptor tyrosine kinase KIT play a critical role in the pathogenesis of systemic mastocytosis (SM) and gastrointestinal stromal tumors. D816V KIT mutation, found in ∼80% of SM, is resistant to the currently available tyrosine kinase inhibitors (TKIs)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique