Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU000571

Sigma-Aldrich

MISSION® esiRNA

targeting human SOAT1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAACGTGCCTCGGGTACTAAATTCAGCTAAGGAGAAATCAAGCACTGTTCCAATACCTACAGTCAACCAGTATTTGTACTTCTTATTTGCTCCTACCCTTATCTACCGTGACAGCTATCCCAGGAATCCCACTGTAAGATGGGGTTATGTCGCTATGAAGTTTGCACAGGTCTTTGGTTGCTTTTTCTATGTGTACTACATCTTTGAAAGGCTTTGTGCCCCCTTGTTTCGGAATATCAAACAGGAGCCCTTCAGCGCTCGTGTTCTGGTCCTATGTGTATTTAACTCCATCTTGCCAGGTGTGCTGATTCTCTTCCTTACTTTTTTTGCCTTTTTGCACTGCTGGCTCAATGCCTTTGCTGAGATGTTACGCTTTGGTGACAGGATGTTCTATAAGGATTGGTGGAACTCCACGTCATACTCCAACTATTATAGAACCTGGAATGTGGTGGTCCATGACTGGCTATATTACTATGCTTACAAGGACTTTCTCTGGTTTTTCTCCAAGAGATTCAAATCTGCTGCCATGTTAGCTGTCTTTGCTGTATCTGCTGTAGTACACGAATATGCCTTGGCTGTTT

Numéro d'accès Ensembl | humain

ENSG00000057252

Numéro d'accès NCBI

NM_003101

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SOAT1(6646) , SOAT1(6646)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhaoe Liu et al.
DNA and cell biology, 35(11), 730-739 (2016-11-01)
Pycnogenol
Yu Xu et al.
Theranostics, 10(24), 11302-11323 (2020-10-13)
Background: Activation of the thermogenic program in white and brown adipocytes presents a promising avenue for increasing energy expenditure during the treatment of obesity. The endogenous mechanism for promoting thermogenesis in brown adipocytes or browning in white adipocytes has indicated
Cameron C Scott et al.
eLife, 7 (2018-09-27)
How trafficking pathways and organelle abundance adapt in response to metabolic and physiological changes is still mysterious, although a few transcriptional regulators of organellar biogenesis have been identified in recent years. We previously found that the Wnt signaling directly controls
Wataru Amano et al.
The Journal of allergy and clinical immunology, 136(3), 667-677 (2015-06-28)
Barrier disruption and the resulting continuous exposure to allergens are presumed to be responsible for the development of atopic dermatitis (AD). However, the mechanism through which skin barrier function is disrupted in patients with AD remains unclear. Taking into account
Feng Geng et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 22(21), 5337-5348 (2016-11-03)
Elevated lipogenesis regulated by sterol regulatory element-binding protein-1 (SREBP-1), a transcription factor playing a central role in lipid metabolism, is a novel characteristic of glioblastoma (GBM). The aim of this study was to identify effective approaches to suppress GBM growth

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique