Skip to Content
Merck
All Photos(1)

Key Documents

EMU185981

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Akap11

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTGGTGTTGTGTGGATTTACTCTCCAGCTACATTACACACTGCAGTAATACAGTTATGGCGGCTTTCCAGCCCCTCAGGAGTAGTCACCTAAAGAGCAAAGCGTCTGTCCGAAAAAGCTTCAGTGAAGATGTGTTCCGGTCTGTAAAGTCTTTATTACAGAGCGAGAAGGAGCTATGCAGTGTATCAGGAGGAGAGTGTTTAAACCAGGATGAGCACCCCCAGTTAACTGAGGTCACGTTTCTGGGCTTTAATGAAGAAACAGATGCTGCTCATATACAGGATCTAGCTGCAGTTTCATTGGAACTTCCAGATCTTCTGAATTCGCTCCATTTTTGCAGTCTAAGTGAAAATGAAATCATTTGTATGAAGGATACCAGTAAATCGTCCAATGTAAGCAGTAGTCCTCTAAATCAGAGTCATCATTCGGGAATGCTTTGTGTCATGAGAGTGTCACCTACATTACCGGGACTCAGAATTGATTTTATCTTTAGTCTCCTAAGTAAATATGCTGCTGGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Simon A Hinke et al.
The EMBO journal, 31(20), 3991-4004 (2012-09-04)
Endocrine release of insulin principally controls glucose homeostasis. Nutrient-induced exocytosis of insulin granules from pancreatic β-cells involves ion channels and mobilization of Ca(2+) and cyclic AMP (cAMP) signalling pathways. Whole-animal physiology, islet studies and live-β-cell imaging approaches reveal that ablation
Michele E Day et al.
The Journal of cell biology, 193(2), 347-363 (2011-04-20)
Although RII protein kinase A (PKA) regulatory subunits are constitutively localized to discrete cellular compartments through binding to A-kinase-anchoring proteins (AKAPs), RI subunits are primarily diffuse in the cytoplasm. In this paper, we report a novel AKAP-dependent localization of RIα

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service