Skip to Content
Merck
All Photos(1)

Key Documents

EMU050341

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sesn2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAGCCTGCAGCCTCACCTATAACACCATCGCCATGCACAGTGGCGTGGACACCTCCATGCTCCGCAGGGCCATCTGGAACTACATCCACTGCGTCTTTGGCATCAGATACGATGACTATGATTACGGCGAGGTAAACCAGCTCCTGGAACGGAACCTCAAAATCTATATCAAGACGGTGGCCTGCTACCCTGAGAAGACGACCCGTAGGATGTACAACCTCTTTTGGAGGCACTTCCGCCACTCAGAGAAGGTTCATGTGAACTTGCTGCTCCTTGAAGCCCGCATGCAAGCGGCCCTGCTCTATGCCCTGCGCGCCATCACCCGCTACATGACCTGACTACCCCGTACGCAGGACCAGCACCAGGAGCAGCTGACCCTGGTCCACCGTCCTCTGTGCAAGGACTTCTGTGTCTGGAGACAGATCTGGGAAGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in
Hiroko Hamatani et al.
American journal of physiology. Renal physiology, 307(6), F708-F717 (2014-07-25)
Sestrin 2, initially identified as a p53 target protein, accumulates in cells exposed to stress and inhibits mammalian target of rapamycin (mTOR) signaling. In normal rat kidneys, sestrin 2 was selectively expressed in parietal epithelial cells (PECs), identified by the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service