Skip to Content
Merck
All Photos(1)

Key Documents

EHU098081

Sigma-Aldrich

MISSION® esiRNA

targeting human CENPA

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACAATCAACACCGTTCCAAAGGCCTGAAAATAATTTTCAGATAAAGAGACTCCAAGGTTGACTTTAGTTTGTGAGTTACTCATGTGACTATTTGAGGATTTTGAAAACATCAGATTTGCTGTGGTATGGGAGAAAAGGCTATGTACTTATTATTTTAGCTCTTTCTGTAATATTTACATTTTTTACCATATGTACATTTGTACTTTTATTTTACACATAAGGGAAAAAATAAGACCACTTTGAGCAGTTGCCTGGAAGGCTGGGCATTTCCATCATATAGACCTCTGCCCTTCAGAGTAGCCTCACCATTAGTGGCAGCATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mamoru Takada et al.
Cancer research, 77(18), 4881-4893 (2017-08-02)
The centromere regulates proper chromosome segregation, and its dysfunction is implicated in chromosomal instability (CIN). However, relatively little is known about how centromere dysfunction occurs in cancer. Here, we define the consequences of phosphorylation by cyclin E1/CDK2 on a conserved
S Zachary Swartz et al.
Developmental cell, 51(1), 35-48 (2019-08-20)
Centromeres provide a robust model for epigenetic inheritance as they are specified by sequence-independent mechanisms involving the histone H3-variant centromere protein A (CENP-A). Prevailing models indicate that the high intrinsic stability of CENP-A nucleosomes maintains centromere identity indefinitely. Here, we
Grégory Eot-Houllier et al.
Nature communications, 9(1), 1888-1888 (2018-05-16)
Sustained spindle tension applied to sister centromeres during mitosis eventually leads to uncoordinated loss of sister chromatid cohesion, a phenomenon known as "cohesion fatigue." We report that Aurora A-dependent phosphorylation of serine 7 of the centromere histone variant CENP-A (p-CENP-AS7)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service