Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EMU196671

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hmga2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGGCATTCGTATAAGAAAAGCATTGTGTGTGACTCTGTGTCCACTCAGATGCCACCCCCACCATGATCATAGAAAATCTGCTTAGGACACCAAAGATGAGAACTAGACACTACTCTCCTTTCTTTGTGTATAATCTTGTAGACACTTACTTGATTTTTTTTTCTTTTTTTACTTTTCAATTCTGAATGAGACAAAATGCTGGTGTATCTTTTCATACAGCTAGCAAACCAGAATAGGTTATGCTCGTTTTTTGCTTTGTTTTGTTTTTCAAAAAGGGAAGTAAACGAGAACCGTTGACTCCTCCATTTATGGACTCATACACAGCAGCAGGAGTGATAAGCCCACAAGCTCTCTTTCCCGCCTCGGGAAATCTACACAGCCAAAAGCCACTTAGCCATAAATGACACTTGTCAGCCTTGAAGCATCGGAGATAACTAGCTGAGTAAAATGATCCTGTTTTGGAATTTAATGAAAAGGTTAACAGTACCCAATGAACCCACCCAAGTGATGAC

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000056758

NCBI-Hinterlegungsnummer

NM_010441

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... HMGA2(15364) , Hmga2(15364)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zhouying Wu et al.
British journal of haematology, 171(5), 818-829 (2015-09-26)
Acute lymphoblastic leukaemia (ALL) in infants is an intractable cancer in childhood. Although recent intensive chemotherapy progress has considerably improved ALL treatment outcome, disease cure is often accompanied by undesirable long-term side effects, and efficient, less toxic molecular targeting therapies
Silvia Parisi et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(3), 1046-1058 (2016-12-07)
Lin28 RNA-binding proteins play important roles in pluripotent stem cells, but the regulation of their expression and the mechanisms underlying their functions are still not definitively understood. Here we address the above-mentioned issues in the first steps of mouse embryonic
Chun-Yu Kao et al.
PeerJ, 4, e1683-e1683 (2016-02-20)
High Mobility Group AT-hook 2 (HMGA2) is a nonhistone chromatin-binding protein which acts as a transcriptional regulating factor involved in gene transcription. In particular, overexpression of HMGA2 has been demonstrated to associate with neoplastic transformation and tumor progression in Colorectal
Liuping Wei et al.
Cellular signalling, 26(7), 1476-1488 (2014-03-25)
We have established that 15-hydroxyeicosatetraenoic acid is an important factor in regulation of pulmonary vascular remodeling (PVR) associated with hypoxia-induced pulmonary hypertension (PH), which is further metabolized by 15-hydroxyprostaglandin dehydrogenase (15-PGDH) to form 15-ketoeicosatetraenoic acid (15-KETE). However, the role of
You-You Xia et al.
Biochemical and biophysical research communications, 463(3), 357-363 (2015-05-31)
Epithelial-mesenchymal transition (EMT) is associated with invasion and metastasis of cancer cells. High-mobility group AT-hook 2 (HMGA2) has been found to play a critical role in EMT in a number of malignant tumors. However, whether HMGA2 regulates the EMT in
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.