Direkt zum Inhalt
Merck

EMU182841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd68

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGCTTGGGGCATATCTGTTTTGAATCCCAACAAAACCAAGGTCCAGGGAGGTTGTGACGGTACCCATCCCCACCTGTCTCTCTCATTTCCTTATGGACAGCTTACCTTTGGATTCAAACAGGACCTACATCAGAGCCCGAGTACAGTCTACCTGGACTACATGGCGGTGGAATACAATGTGTCCTTCCCACAGGCAGCACAGTGGACATTCATGGCGCAGAATTCATCTCTTCGAGAGCTCCAAGCTCCCTTGGGCCAAAGCTTCTGCTGTGGAAATGCAAGCATAGTTCTTTCTCCAGCTGTTCACCTTGACCTGCTCTCTCTAAGGCTACAGGCTGCTCAGCTGCCTGACAAGGGACACTTCGGGCCATGTTTCTCTTGCAACCGTGACCAGTCCCTCTTGCTGCCTCTCATCATTGGCCTGGTCCTCCTCGGCCTCCTCACCCTGGTGCTCATCGCCTTCTGCATCACCCGCAGACGACAATCAACCTACCAGCCCCTCTGAGCATC

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Asif Manzoor Khan et al.
Neurobiology of aging, 36(6), 2164-2175 (2015-04-22)
The susceptibility of the aging brain to neurodegenerative disease may in part be attributed to cellular aging of the microglial cells that survey it. We investigated the effect of cellular aging induced by telomere shortening on microglia by the use
Bao-xiang Pei et al.
The Journal of thoracic and cardiovascular surgery, 148(4), 1208-1216 (2014-06-08)
Recent experimental evidence has indicated that interstitial tumor-associated macrophages (TAMs), tumor-derived macrophage colony-stimulating factor (also known as CSF-1), and interleukin-6 (IL-6) interact in the pathogenesis of malignant epithelial tumors, including lung cancer. The present study aimed to explore their relationship
Carlos Tarin et al.
Scientific reports, 5, 17135-17135 (2015-12-01)
CD163 is a membrane receptor expressed by macrophage lineage. Studies performed in atherosclerosis have shown that CD163 expression is increased at inflammatory sites, pointing at the presence of intraplaque hemorrhagic sites or asymptomatic plaques. Hence, imaging of CD163 expressing macrophages
Andrea Doni et al.
The Journal of experimental medicine, 212(6), 905-925 (2015-05-13)
Pentraxin 3 (PTX3) is a fluid-phase pattern recognition molecule and a key component of the humoral arm of innate immunity. In four different models of tissue damage in mice, PTX3 deficiency was associated with increased fibrin deposition and persistence, and

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.