Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EMU173171

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Chn1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTGAAGATGTCAAGATGGCTTTTGATAGAGATGGTGAGAAGGCGGATATTTCTGTGAACATGTATGAGGACATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATCTGCCAATTCCTCTCATCACATACGATGCCTACCCCAAGTTCATTGAGTCTGCCAAAATTATGGACCCTGACGAGCAATTGGAGACCCTTCACGAAGCACTGAGATCGCTGCCGCCTGCCCACTGCGAGACGCTCCGGTACCTCATGGCGCATCTCAAGAGAGTGACCCTTCATGAGAAGGAGAATCTGATGAGTGCAGAGAACCTTGGGATCGTGTTTGGACCAACCCTCATGAGATCCCCAGAGCTCG

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000056486

NCBI-Hinterlegungsnummer

NM_029716

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... CHN1(108699) , Chn1(108699)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Junlan Feng et al.
Journal of cellular and molecular medicine, 18(10), 2125-2134 (2014-09-19)
Our previously published study documented a deregulation of the microRNA miR-150 in colorectal cancer. Here, we investigated further, in vitro and in vivo, the potential molecular mechanisms underlying the involvement of miR-150 in colorectal cancer, using the appropriate molecular biological
Chao Zeng et al.
American journal of physiology. Endocrinology and metabolism, 307(4), E384-E397 (2014-07-10)
Activation of conventional PKCs (cPKC) is a key signaling that directs the cardiac toxicity of hyperglycemia. AKAP150, a scaffold protein of the A-kinase anchoring proteins (AKAPs) family, is less defined regarding its capability to anchor and regulate cardiac cPKC signaling.
Han Lin et al.
Molecular and cellular biology, 35(21), 3657-3668 (2015-08-19)
Cdc14 is a phosphatase that controls mitotic exit and cytokinesis in budding yeast. In mammals, the two Cdc14 homologues, Cdc14A and Cdc14B, have been proposed to regulate DNA damage repair, whereas the mitotic exit and cytokinesis rely on another phosphatase
Peng Yang et al.
Cellular signalling, 27(7), 1525-1532 (2015-03-18)
Surgery-induced inflammation has been associated with cancer recurrence and metastasis in colorectal cancer (CRC). As a constituent of gram-negative bacteria, lipopolysaccharide (LPS) is frequently abundant in the peri-operative window. However, the definite roles of LPS in tumour progression remain elusive.
Deguang Xing et al.
Oncology reports, 31(6), 2692-2700 (2014-04-24)
In the present study, we designed and conducted a series of assays to determine the expression of voltage-gated sodium channel (VGSC) neonatal isoform Nav1.5 (nNav1.5) in human brain astrocytoma and its effect on the proliferation, migration, invasion and apoptosis of
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.