Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EMU077671

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sod2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAGGAGCAAGGTCGCTTACAGATTGCTGCCTGCTCTAATCAGGACCCATTGCAAGGAACAACAGGCCTTATTCCGCTGCTGGGGATTGACGTGTGGGAGCACGCTTACTACCTTCAGTATAAAAACGTCAGACCTGACTATCTGAAAGCTATTTGGAATGTAATCAACTGGGAGAATGTTACTGAAAGATACACAGCTTGCAAGAAGTGAAACCTCACTCACGGCCACATTGAGTGCCAGGCTCCGGGCTGGTTTATAGTAGTGTAGAGCATTGCAGCACTATGACTGGGGTGCTGTAGTCTTTATTGATGTCTTTCCACATACCTGATAATTCTATGATAATTTCTTATTTTAATTAAATCTATTCTTAGGCAACTATTTGAGAACAGCGCATACTCTGTGTGAATTGCTCTTGATTGAACATTTTCGTTAGAGCCTTGAATTGCTTGGA

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000006818

NCBI-Hinterlegungsnummer

NM_013671

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... SOD2(20656) , Sod2(20656)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Y Xu et al.
Oncogene, 34(32), 4229-4237 (2014-11-05)
Manganese superoxide dismutase (MnSOD) is a mitochondrially localized primary antioxidant enzyme, known to be essential for the survival of aerobic life and to have important roles in tumorigenesis. Here, we show that MnSOD deficiency in skin tissues of MnSOD-heterozygous knockout
Vonetta M Williams et al.
Journal of virology, 88(12), 6751-6761 (2014-04-04)
High-risk types of human papillomavirus (HPV) are the causative agents of virtually all cases of cervical cancer and a significant proportion of other anogenital cancers, as well as both oral and pharyngeal cancers. The high-risk types encode two viral oncogenes
Jiahong Sun et al.
Molecular pharmacology, 88(3), 437-449 (2015-06-18)
Oxidative stress is linked to mitochondrial dysfunction in aging and neurodegenerative conditions. The transcription factor nuclear factor E2-related factor 2 (Nrf2)-antioxidant response element (ARE) regulates intracellular antioxidative capacity to combat oxidative stress. We examined the effect of tert-butylhydroquinone (tBHQ), an
Yasuhiro Ishihara et al.
The Journal of biological chemistry, 290(37), 22805-22817 (2015-08-02)
Microglia are activated quickly in response to external pathogens or cell debris and clear these substances via the inflammatory response. However, excessive activation of microglia can be harmful to host cells due to the increased production of reactive oxygen species
Sabrina Krautbauer et al.
Molecular and cellular biochemistry, 393(1-2), 69-76 (2014-04-18)
Adipogenesis is associated with the upregulation of the antioxidative enzyme manganese superoxide dismutase (MnSOD) suggesting a vital function of this enzyme in adipocyte maturation. In the current work, MnSOD was knocked-down with small-interference RNA in preadipocytes to study its role

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.