Direkt zum Inhalt
Merck

EMU074771

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bcl2l11

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATCGGAGACGAGTTCAACGAAACTTACACAAGGAGGGTGTTTGCAAATGATTACCGCGAGGCTGAAGACCACCCTCAAATGGTTATCTTACAACTGTTACGCTTTATCTTCCGTCTGGTATGGAGAAGGCATTGACAGGATCTACATGCAGCCAGGATACGTGGCGGACATGGCTCTTGTTCAGACTGGGAGAACCCCCACGCGTCATGTCCCTCTCTTGGTGCTGCGACAGTGTGTCCAGTGGTTCTATCCCAGAGAGATGTGCTGAGCATGGACAGCGCTCTGCACTGTGTCGATGTGAACGGAACCTCTGTTCATCACCACATGGCCGAGTTTTCAGTAAATATTTGTTGTGAATGTAAACAAGGGAGGGCTTTTCTCTTTTTAATGTACAGATCCTAGGAACAGAGAAATATGCAAGAGAGGTGTTTACATGTGGCGTG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Oluwafunmilayo F Lamidi et al.
Journal of cancer research and clinical oncology, 141(9), 1575-1583 (2015-01-31)
Tubulysins are natural tetrapeptides that inhibit tubulin polymerisation. Tubulysins are very potent inhibitors of mammalian cancer cell growth, but restricted availability has limited their characterisation and development as anti-cancer compounds. KEMTUB10 was recently developed as a synthetic analogue of natural
Gong-Quan Li et al.
Oncotarget, 7(3), 2462-2474 (2015-11-18)
Bromodomain 4 (BRD4) is an epigenetic regulator that, when inhibited, has anti-cancer effects. In this study, we investigated whether BRD4 could be a target for treatment of human hepatocellular carcinoma (HCC). We show that BRD4 is over-expressed in HCC tissues.
S L Locatelli et al.
Leukemia, 28(9), 1861-1871 (2014-02-25)
Relapsed/refractory Hodgkin's lymphoma (HL) is an unmet medical need requiring new therapeutic options. Interactions between the histone deacetylase inhibitor Givinostat and the RAF/MEK/ERK inhibitor Sorafenib were examined in HDLM-2 and L-540 HL cell lines. Exposure to Givinostat/Sorafenib induced a synergistic
Anja Heinemann et al.
Oncotarget, 6(25), 21507-21521 (2015-06-19)
Histone acetylation marks have an important role in controlling gene expression and are removed by histone deacetylases (HDACs). These marks are read by bromodomain and extra-terminal (BET) proteins and novel inhibitiors of these proteins are currently in clinical development. Inhibitors
Lin Deng et al.
The Journal of general virology, 96(9), 2670-2683 (2015-08-25)
We previously reported that hepatitis C virus (HCV) infection induces Bax-triggered, mitochondrion-mediated apoptosis by using the HCV J6/JFH1 strain and Huh-7.5 cells. However, it was still unclear how HCV-induced Bax activation. In this study, we showed that the HCV-induced activation

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.