Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EMU061611

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pdpn

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATGGCTTGCCAGTAGTCACCCTGGTTGGAATCATAGTTGGCGTCTTGTTAGCCATTGGCTTCGTCGGAGGGATCTTCATTGTTGTTATGAAGAAGATTTCTGGAAGGTCTCGCCCTAAAGAGCTAAACAGAACAGGTTGTTCTCCCAACACATCTGAAAATAAGAGAGCTTCCAACTTGCCCTGTTCCCCATCCTCTTCCTGTGGAGGAAGATGACCCATGGCGTGCCCACCCACCCCACCCACAGCCATGGTGACCCCTCCGCTTGGCCAGCAGTACCAAAGGAAAGATACAGGACAAGCCACAGCCCCTCAAAGCATCTGCCTTTGGAAAACTAAATTTTTAACATAAATGTTATGATCGATGATTCAAAAGACAACATGCTTAGAAAATGGAGCAAAGCCAA

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000028583

NCBI-Hinterlegungsnummer

NM_010329

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... PDPN(14726) , Pdpn(14726)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Frédéric Larrieu-Lahargue et al.
PloS one, 7(6), e39540-e39540 (2012-07-05)
Fibroblast Growth Factor receptor (FGFR) activity plays crucial roles in tumor growth and patient survival. However, FGF (Fibroblast Growth Factor) signaling as a target for cancer therapy has been under-investigated compared to other receptor tyrosine kinases. Here, we studied the
René Hägerling et al.
The EMBO journal, 32(5), 629-644 (2013-01-10)
During mammalian development, a subpopulation of endothelial cells in the cardinal vein (CV) expresses lymphatic-specific genes and subsequently develops into the first lymphatic structures, collectively termed as lymph sacs. Budding, sprouting and ballooning of lymphatic endothelial cells (LECs) have been
Hyun-Yi Kim et al.
Oncology reports, 34(2), 833-842 (2015-06-18)
We investigated the clinical significance of podoplanin expression in relation to clinicopathological variables in head and neck squamous cell carcinoma (HNSCC), to determine its effectiveness as a marker for high-risk HNSCC patients. Upregulation of podoplanin in HNSCC tissues was examined
Yoshihiko Sawa et al.
PloS one, 9(5), e97165-e97165 (2014-05-20)
The toll-like receptor (TLR) has been suggested as a candidate cause for diabetic nephropathy. Recently, we have reported the TLR4 expression in diabetic mouse glomerular endothelium. The study here investigates the effects of the periodontal pathogen Porphyromonas gingivalis lipopolysaccharide (LPS)
Yan Song et al.
Cellular and molecular neurobiology, 34(6), 839-849 (2014-05-14)
Podoplanin (PDPN) is a mucin-type transmembrane sialoglycoprotein expressed in multiple tissues in adult animals, including the brain, lungs, kidney, and lymphoid organs. Studies of this molecule have demonstrated its great importance in tumor metastasis, platelet aggregation, and lymphatic vessel formation.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.