Direkt zum Inhalt
Merck

EMU055151

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hdac6

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTGGTACTTCCCATCGCCTATGAGTTTAACCCAGAACTGGTGCTGATCTCAGCTGGCTTTGATGCTGCACAAGGGGATCCGCTGGGGGGCTGCCAAGTAACACCGGAAGGTTATGCCCACCTCACCCACCTACTGATGGGCCTTGCTGGTGGCCGTATTATTCTTATTCTAGAGGGTGGATACAATTTGGCATCTATCTCTGAGTCTATGGCTGCCTGCACCCATTCCCTCCTTGGAGACCCACCACCCCAGCTTACTTTGCTGCGACCGCCACAGTCAGGAGCCCTGGTTTCAATCAGTGAGGTCATCCAAGTCCATCGCAAATACTGGCGCAGTTTGCGGTTGAGTAAAATGGAAGACAAGGAAGAATGCTCTAGTTCTAGGCTTGTCGTCAAGAAGTTGCCCCCAACAGCCAGTCCTGTATCAGCTAAGGAAATGACCACACCGAAAGGAAAGGTTCCTGAAGAAAGCGTGAGGAAGACCA

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Smita Salian-Mehta et al.
The Journal of biological chemistry, 290(22), 14045-14056 (2015-04-16)
The impact of histone deacetylases (HDACs) in the control of gonadotropin releasing hormone (GnRH) neuronal development is unknown. We identified an increase in many HDACs in GT1-7 (differentiated) compared with NLT (undifferentiated) GnRH neuronal cell lines. Increased HDAC9 mRNA and
Regina Kanski et al.
Journal of cell science, 127(Pt 20), 4368-4380 (2014-08-17)
Glial fibrillary acidic protein (GFAP) is the main intermediate filament in astrocytes and is regulated by epigenetic mechanisms during development. We demonstrate that histone acetylation also controls GFAP expression in mature astrocytes. Inhibition of histone deacetylases (HDACs) with trichostatin A
Yixuan Li et al.
Molecular and cellular biology, 35(20), 3547-3565 (2015-08-05)
Histone deacetylase (HDAC) inhibition leads to cell cycle arrest in G1 and G2, suggesting HDACs as therapeutic targets for cancer and diseases linked to abnormal cell growth and proliferation. Many HDACs are transcriptional repressors. Some may alter cell cycle progression
María-Soledad Valera et al.
Retrovirology, 12, 53-53 (2015-06-25)
Human immunodeficiency virus type 1 (HIV-1) has evolved a complex strategy to overcome the immune barriers it encounters throughout an organism thanks to its viral infectivity factor (Vif), a key protein for HIV-1 infectivity and in vivo pathogenesis. Vif interacts

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.