Direkt zum Inhalt
Merck

EMU039131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Plk1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGCTACAGCAGCTGACCAGTGTCAACGCCTCCAAGCCCTCGGAGCGCGGGCTGGTGCGGCAAGAGGAGGCTGAGGATCCTGCCTGCATCCCCATCTTCTGGGTCAGCAAGTGGGTGGACTATTCGGACAAGTATGGCCTTGGGTATCAGCTGTGTGACAACAGTGTGGGGGTGCTTTTTAATGACTCAACACGCCTGATTCTCTACAATGACGGGGACAGCCTGCAGTACATAGAGCGTGATGGCACGGAGTCCTATCTCACTGTGAGCTCCCATCCCAATTCCTTGATGAAGAAGATCACTCTCCTCAACTATTTCCGCAATTACATGAGTGAGCACCTGCTGAAGGCAGGACGCAACATCACACCCCGGGAAGGCGACGAGCTGGCCCGGCTGCCCTACCTACGAACGTGGTTCCGCACACGCAGCGCCATCATCCTGCACCTCAGCAACGGCACCGTGCAGATTAACTTCTTCCAGGACCACACCAAACTTATCCTGTGCCCCCT

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Riet van der Meer et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3211-3221 (2014-04-29)
To identify genes whose depletion is detrimental to Pim1-overexpressing prostate cancer cells and to validate this finding in vitro and in vivo. RNAi screening was used to identify genes whose depletion is detrimental to Pim1-overexpressing cells. Our finding was validated
Valentina Zuco et al.
Oncotarget, 6(11), 8736-8749 (2015-04-01)
Intrinsic and acquired tumor drug resistance limits the therapeutic efficacy of camptothecins (CPTs). Downregulation of the mitotic kinase PLK1 was found associated with apoptosis induced by SN38 (CPT11 active metabolite). We investigated the role of PLK1 in the cell response
Hui Tian et al.
Molecular cancer research : MCR, 13(4), 784-794 (2015-01-13)
Protein S-palmitoylation is a widespread and dynamic posttranslational modification that regulates protein-membrane interactions, protein-protein interactions, and protein stability. A large family of palmitoyl acyl transferases, termed the DHHC family due to the presence of a common catalytic motif, catalyzes S-palmitoylation;
Sixin Jiang et al.
Respiratory research, 16, 93-93 (2015-08-06)
Polo-like kinase 1 (Plk1) is a serine/threonine protein kinase that has been implicated in the regulation of mitosis. In addition, the activation of mitogen-activated protein kinase (MAPK) is a key event in the early stage of the growth factor response.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.