Direkt zum Inhalt
Merck

EMU028841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rac1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTCACACAGCGAGGACTCAAGACAGTGTTTGACGAAGCTATCCGAGCGGTTCTCTGTCCCCCTCCTGTCAAGAAGAGGAAGAGAAAATGCCTGCTGTTGTAAATGTCGGAGCCCCTCGTTCTCGGTCCTGCCTGGAACCTTTGTACGCTTTGCTCAAAAATCAGCGAGCCTTCGCATTTGATGCCAAGTTTTTGTTACAGATTAATTTTTCCATAAAACCATTTTGAACCAATGAACCAGTCAATAATTTTAAGGTTCTGTTTTAAATGTAAGAATTCCAACTTACAGTCTATTAAAATTCAGCCCTAAAATGACAAAGCCTTCTTAAAGCCTTATTTTTAAAATCCCCCATTCTTGCTCAGATTAAAAATTGCCAAAATACCTTCTGAACTAAGTTGCGTTGTGCTGAGAACACCTAAGCACTAAACTCTCTTGAGAGACTTCTGTTGCTAAGAAGACCGCAGC

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

12 - Non Combustible Liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hongxue Shi et al.
International journal of biological sciences, 11(7), 845-859 (2015-06-17)
Fibroblasts play a pivotal role in the process of cutaneous wound repair, whereas their migratory ability under diabetic conditions is markedly reduced. In this study, we investigated the effect of basic fibroblast growth factor (bFGF) on human dermal fibroblast migration
Laurent Pieuchot et al.
Nature communications, 9(1), 3995-3995 (2018-09-30)
Cells have evolved multiple mechanisms to apprehend and adapt finely to their environment. Here we report a new cellular ability, which we term "curvotaxis" that enables the cells to respond to cell-scale curvature variations, a ubiquitous trait of cellular biotopes.
S Skvortsov et al.
British journal of cancer, 110(11), 2677-2687 (2014-05-03)
In order to improve therapy for HNSCC patients, novel methods to predict and combat local and/or distant tumour relapses are urgently needed. This study has been dedicated to the hypothesis that Rac1, a Rho GTPase, is implicated in HNSCC insensitivity
Cuong Thach Nguyen et al.
Infection and immunity, 82(9), 3802-3810 (2014-07-02)
Caseinolytic protease L (ClpL) is a member of the HSP100/Clp chaperone family, which is found mainly in Gram-positive bacteria. ClpL is highly expressed during infection for refolding of stress-induced denatured proteins, some of which are important for adherence. However, the
Vianey Gonzalez-Villasana et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 21(9), 2127-2137 (2015-01-18)
Zoledronic acid is being increasingly recognized for its antitumor properties, but the underlying functions are not well understood. In this study, we hypothesized that zoledronic acid inhibits ovarian cancer angiogenesis preventing Rac1 activation. The biologic effects of zoledronic acid were

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.