Direkt zum Inhalt
Merck

EMU025631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Areg

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGGCAGTGAACTCTCCACAGGGGACTACGACTACTCAGAGGAGTATGATAATGAACCACAAATATCCGGCTATATTATAGATGATTCAGTCAGAGTTGAACAGGTGATTAAGCCCAAGAAAAACAAGACAGAAGGAGAAAAGTCTACAGAAAAACCCAAAAGGAAGAAAAAGGGAGGCAAAAATGGAAAAGGCAGAAGGAATAAGAAGAAAAAGAATCCATGCACTGCCAAGTTTCAGAACTTTTGCATTCATGGCGAATGCAGATACATCGAGAACCTGGAGGTGGTGACATGCAATTGTCATCAAGATTACTTTGGTGAACGGTGTGGAGAAAAATCCATGAAGACTCACAGCGAGGATGACAAGGACCTATCCAAGATTGCAGTAGTAGCTGTCACTATCTTTGTCTCTGCCATCATCCTCGCAGCTATTGGCATCGGCATCGTTATCACAG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Valerie N Barton et al.
Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)
Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third
Xianwei Li et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 19(5), 401-411 (2015-09-04)
Aldose reductase (AR) is known to play a crucial role in the mediation of diabetic and cardiovascular complications. Recently, several studies have demonstrated that allergen-induced airway remodeling and ovalbumin-induced asthma is mediated by AR. Epalrestat is an aldose reductase inhibitor
Tao Shan et al.
Cancer science, 105(7), 847-856 (2014-05-13)
Norepinephrine and epinephrine, catecholamine hormones that are major mediators for chronic stress-induced cancers, are implicated in the progression of a number of cancer cells, including gastric adenocarcinoma. However, the underlying mechanisms of these hormones have not been well elucidated. Epithelial-mesenchymal
Xiaolong Du et al.
Experimental biology and medicine (Maywood, N.J.), 240(11), 1472-1479 (2015-05-15)
Angiogenesis is critical to wound repair due to its role in providing oxygen and nutrients that are required to support the growth and function of reparative cells in damaged tissues. Adenosine receptors are claimed to be of paramount importance in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.