Direkt zum Inhalt
Merck

EHU154181

Sigma-Aldrich

MISSION® esiRNA

targeting human NOL3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAGGGACGAGTCCGAAGATTCCTGAAGGCCAGAGCTCTGACAGGCGGTGCCCCGCCCATGCTGGATAGGACCTGGGATGCTGCTGGAGCTGAATCGGATGCCACCAAGGCTCGGTCCAGCCCAGTACCGCTGGAAGTGAATAAACTCCGGAGGGTCGGACGGGACCTGGGCTCTCTCCACGATTCTGGCTGTTTGCCCAGGAACTTAGGGTGGGTACCTCTGAGTCCCAGGGACCTGGGCAGGCCCAAGCCCACCACGAGCATCATCCAGTCCTCAGCCCTAATCTGCCCTTAGGAGTCCAGGCTGCACCCTGGAGATCCCAAACCTAGCCCCCTAGTGGGACAAGGACCTGACCCTCCTGCCCGCATACACAACCCATTTCCCCTGGTGAGCCACTTGGCAGCATATGTAGGTACCAGCTCAACCCCACGCAAGTTCCTGAGCTGAACATGGAGCAAGGGGAGGGTGACTTCTCTCCACATAGGGAGGGCTTAGAGCTCACAGCCTTGGGAAGTGAGACTAGAAGAGGGGAGCAGAAAGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Csaba Toth et al.
Cell communication and signaling : CCS, 15(1), 16-16 (2017-05-04)
Renal cell carcinomas (RCCs) display broad resistance against conventional radio- and chemotherapies, which is due at least in part to impairments in both extrinsic and intrinsic apoptotic pathways. One important anti-apoptotic factor that is strongly overexpressed in RCCs and known
Fang Xie et al.
Acta physiologica (Oxford, England), 228(2), e13337-e13337 (2019-07-02)
Cardiac hypertrophy and myocardial apoptosis are two major factors in heart failure. As a classical regulator of apoptosis, apoptosis repressor with caspase recruitment domain (ARC) has recently also been found to have a protective effect against hypertrophy. However, the mechanism
Christopher DeBoever et al.
Nature communications, 9(1), 1612-1612 (2018-04-25)
Protein-truncating variants can have profound effects on gene function and are critical for clinical genome interpretation and generating therapeutic hypotheses, but their relevance to medical phenotypes has not been systematically assessed. Here, we characterize the effect of 18,228 protein-truncating variants
David Kozono et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(30), E4055-E4064 (2015-07-15)
The available evidence suggests that the lethality of glioblastoma is driven by small subpopulations of cells that self-renew and exhibit tumorigenicity. It remains unclear whether tumorigenicity exists as a static property of a few cells or as a dynamically acquired
Fengfei Wang et al.
Oncotarget, 6(5), 2709-2724 (2015-01-13)
Over-expression of PDGF receptors (PDGFRs) has been previously implicated in high-risk medulloblastoma (MB) pathogenesis. However, the exact biological functions of PDGFRα and PDGFRβ signaling in MB biology remain poorly understood. Here, we report the subgroup specific expression of PDGFRα and

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.