Direkt zum Inhalt
Merck

EHU152001

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP14

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCAGAAGTTTTACGGCTTGCAAGTAACAGGCAAAGCTGATGCAGACACCATGAAGGCCATGAGGCGCCCCCGATGTGGTGTTCCAGACAAGTTTGGGGCTGAGATCAAGGCCAATGTTCGAAGGAAGCGCTACGCCATCCAGGGTCTCAAATGGCAACATAATGAAATCACTTTCTGCATCCAGAATTACACCCCCAAGGTGGGCGAGTATGCCACATACGAGGCCATTCGCAAGGCGTTCCGCGTGTGGGAGAGTGCCACACCACTGCGCTTCCGCGAGGTGCCCTATGCCTACATCCGTGAGGGCCATGAGAAGCAGGCCGACATCATGATCTTCTTTGCCGAGGGCTTCCATGGCGACAGCACGCCCTTCGATGGTGAGGGCGGCTTCCTGGCCCATGCCTACTTCCCAGGCCCCAACATTGGAGGAGACACCCACT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Po-Hsiang Chang et al.
Scientific reports, 8, 45751-45751 (2017-04-04)
Cancer stem cells (CSCs), a small population of cancer cells, have been considered to be the origin of cancer initiation, recurrence, and metastasis. Tumor microenvironment provides crucial signals for CSCs to maintain stem cell properties and promotes tumorigenesis. Therefore, establishment
Shawn P Carey et al.
Scientific reports, 7, 42088-42088 (2017-02-12)
A critical step in breast cancer progression is local tissue invasion, during which cells pass from the epithelial compartment to the stromal compartment. We recently showed that malignant leader cells can promote the invasion of otherwise non-invasive epithelial follower cells
Pirita Pekkonen et al.
eLife, 7 (2018-05-02)
Lymphatic invasion and lymph node metastasis correlate with poor clinical outcome in melanoma. However, the mechanisms of lymphatic dissemination in distant metastasis remain incompletely understood. We show here that exposure of expansively growing human WM852 melanoma cells, but not singly
Evelyne Tassone et al.
Journal of cellular physiology, 230(2), 366-377 (2014-07-06)
Membrane-type 1 matrix metalloproteinase (MT1-MMP, MMP-14), a transmembrane proteinase with an extracellular catalytic domain and a short cytoplasmic tail, degrades extracellular matrix components and controls diverse cell functions through proteolytic and non-proteolytic interactions with extracellular, intracellular, and transmembrane proteins. Here
Bi-Sen Ding et al.
Journal of cell science, 128(16), 2983-2988 (2015-06-28)
Human airway basal cells are the stem (or progenitor) population of the airway epithelium, and play a central role in anchoring the epithelium to the basement membrane. The anatomic position of basal cells allows for potential paracrine signaling between them

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.