Direkt zum Inhalt
Merck

EHU148691

Sigma-Aldrich

MISSION® esiRNA

targeting human ALOX5

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGCAAGTACTGGCTGAATGACGACTGGTACCTGAAGTACATCACGCTGAAGACGCCCCACGGGGACTACATCGAGTTCCCCTGCTACCGCTGGATCACCGGCGATGTCGAGGTTGTCCTGAGGGATGGACGCGCAAAGTTGGCCCGAGATGACCAAATTCACATTCTCAAGCAACACCGACGTAAAGAACTGGAAACACGGCAAAAACAATATCGATGGATGGAGTGGAACCCTGGCTTCCCCTTGAGCATCGATGCCAAATGCCACAAGGATTTACCCCGTGATATCCAGTTTGATAGTGAAAAAGGAGTGGACTTTGTTCTGAATTACTCCAAAGCGATGGAGAACCTGTTCATCAACCGCTTCATGCACATGTTCCAGTCTTCTTGGAATGACTTCGCCGACTTTGAGAAA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Alana N Vagnozzi et al.
Translational psychiatry, 7(12), 1288-1288 (2017-12-19)
Neurodegenerative tauopathies are characterized by pathological accumulation of highly phosphorylated isoforms of tau protein, which leads to progressive neuronal loss. Neuroinflammation often accompanies tau-driven diseases; however, the direct role of neuroinflammation in tauopathies remains unknown. The 5-lipoxygenase (5LO) is a
Hyun Jeong Kwak et al.
Scientific reports, 7(1), 5025-5025 (2017-07-12)
Leukotriene B4 (LTB4) production via the 5-lipoxygenase (5-LO) pathway contributes to the development of insulin resistance in adipose and hepatic tissues, but the role of LTB4 in skeletal muscle is relatively unknown. Here, the authors investigated the role of LTB4
Bishuang Cai et al.
Science signaling, 11(549) (2018-09-27)
Inflammation resolution counterbalances excessive inflammation and restores tissue homeostasis after injury. Failure of resolution contributes to the pathology of numerous chronic inflammatory diseases. Resolution is mediated by endogenous specialized proresolving mediators (SPMs), which are derived from long-chain fatty acids by
Seon Min Woo et al.
Oncotarget, 8(63), 106672-106684 (2018-01-02)
Cathepsin G is a serine protease secreted from activated neutrophils, it has important roles in inflammation and immune response. Moreover, cathepsin G promotes tumor cell-cell adhesion and migration in cancer cells. In this study, we investigated whether inhibition of cathepsin
Olga Scherer et al.
Journal of immunological methods, 422, 118-124 (2015-04-22)
Monocytes are an important constituent of the innate immune system. Therefore, manipulating gene expression of primary human monocytes is a crucial mean to study and characterize the functions of targeted proteins in monocytes. Gene silencing by transfection of cells with

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.