Direkt zum Inhalt
Merck

EHU146001

Sigma-Aldrich

MISSION® esiRNA

targeting human P2RX7

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTGCCGTCCCAAATACAGTTTCCGTCGCCTTGACGACAAGACCACCAACGTGTCCTTGTACCCTGGCTACAACTTCAGATACGCCAAGTACTACAAGGAAAACAATGTTGAGAAACGGACTCTGATAAAAGTCTTCGGGATCCGTTTTGACATCCTGGTTTTTGGCACCGGAGGAAAATTTGACATTATCCAGCTGGTTGTGTACATCGGCTCAACCCTCTCCTACTTCGGTCTGGCCGCTGTGTTCATCGACTTCCTCATCGACACTTACTCCAGTAACTGCTGTCGCTCCCATATTTATCCCTGGTGCAAGTGCTGTCAGCCCTGTGTGGTCAACGAATACTACTACAGGAAGAAGTGCGAGTCCATTGTGGAGCCAAAGCCGACATTAAAGTATGTGTCCTTTGTGGATGAATCCCAC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Wang Lili et al.
Experimental biology and medicine (Maywood, N.J.), 244(9), 734-742 (2019-05-02)
The mechanism of gastric cancer is highly complex, accompanied by a variety of genetic abnormalities. It is of great significance to elucidate the pathogenesis of gastric cancer, find its markers and therapeutic targets in the fight against this fatal disease.
Hengli Zhao et al.
Scientific reports, 6, 23286-23286 (2016-03-17)
Blockading P2X7 receptor(P2X7R) provides neuroprotection toward various neurological disorders, including stroke, traumatic brain injury, and subarachnoid hemorrhage. However, whether and how P2X7 receptor suppression protects blood-brain barrier(BBB) after intracerebral hemorrhage(ICH) remains unexplored. In present study, intrastriatal autologous-blood injection was used
Shu Guan et al.
Frontiers in psychiatry, 10, 770-770 (2019-11-05)
Diabetic neuropathic pain (DNP) and major depressive disorder (MDD) are common complications of diabetes mellitus and mutually affect each other. As a member of the ATP-gated ion channel family, P2X7 receptor is associated with the transduction of pain signal and
Hui Pan et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13533-13543 (2016-07-30)
Uveal melanoma (UM) has a high mortality rate for primary intraocular tumors. Approximately half of UM patients present with untreatable and fatal metastases. Long non-coding RNAs (lncRNAs) have emerged as potent regulatory RNAs that play key roles in various cellular
Miso Park et al.
Scientific reports, 9(1), 11587-11587 (2019-08-14)
Tamoxifen (TAM) is the standard anti-hormonal therapy for estrogen receptor-positive breast cancer. However, long-term TAM therapy can make acquisition of TAM resistance and there are still no solutions to treat TAM-resistant breast cancer. In this study, we found that protein

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.