Direkt zum Inhalt
Merck

EHU137641

Sigma-Aldrich

MISSION® esiRNA

targeting human ARF6

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GAGAGGCTTCGTTTCGGTTTCGCGGCGGCGGCGGCGTTGTTGGCTGAGGGGACCCGGGACACCTGAATGCCCCCGGCCCCGGCTCCTCCGACGCGATGGGGAAGGTGCTATCCAAAATCTTCGGGAACAAGGAAATGCGGATCCTCATGTTGGGCCTGGACGCGGCCGGCAAGACAACAATCCTGTACAAGTTGAAGCTGGGCCAGTCGGTGACCACCATTCCCACTGTGGGTTTCAACGTGGAGACGGTGACTTACAAAAATGTCAAGTTCAACGTATGGGATGTGGGCGGCCAGGACAAGATCCGGCCGCTCTGGCGGCATTACTACACTGGGACCCAAGGTCTCATCTTCGTAGTGGACTGCGCCGACCGCGACCGCATCGATGAGGCTCGCCAGGAGCTGCACCGCATTATCAATGACCGGGAGATGAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yujie Zhang et al.
Oncotarget, 6(9), 7244-7261 (2015-03-18)
Wnt5a, a ligand for activating the non-canonical Wnt signaling pathway, is commonly associated with Epithelial-to-mesenchymal transition (EMT) in cancer cell metastasis. Here, we show that downregulation of Wnt5a mRNA and protein by EGF is necessary for EGF-induced EMT in gastric
Yueh-Chien Lin et al.
Scientific reports, 7(1), 11431-11431 (2017-09-14)
The small GTPase Arf6 plays pivotal roles in a wide variety of cellular events such as endocytosis, exocytosis, and actin cytoskeleton reorganization. However, the physiological functions of Arf6 at the whole animal level have not yet been thoroughly understood. Here
Vahitha B Abdul-Salam et al.
Circulation research, 124(1), 52-65 (2018-12-26)
Increased expression of CLIC4 (chloride intracellular channel 4) is a feature of endothelial dysfunction in pulmonary arterial hypertension, but its role in disease pathology is not fully understood. To identify CLIC4 effectors and evaluate strategies targeting CLIC4 signaling in pulmonary
Mohamed Bourmoum et al.
Journal of cell science, 131(11) (2018-05-05)
Sister chromatid cohesion, facilitated by the cohesin protein complex, is crucial for the establishment of stable bipolar attachments of chromosomes to the spindle microtubules and their faithful segregation. Here, we demonstrate that the GTPase ARF6 prevents the premature loss of
Jamie S Lin et al.
PloS one, 12(9), e0184575-e0184575 (2017-09-08)
ADP-ribosylation factor 6 (ARF6) is a small GTPase necessary for regulating cellular structure, motility, and vesicle trafficking. In several cellular systems, ARF6 was shown to regulate actin dynamics in coordination with Rac1, a Rho small GTPase. We examined the function

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.