Direkt zum Inhalt
Merck

EHU135251

Sigma-Aldrich

MISSION® esiRNA

targeting human HIPK2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTGGCCGTTATATCCAGGAGCTTCGGAGTATGATCAGATTCGGTATATTTCACAAACACAGGGTTTGCCTGCTGAATATTTATTAAGCGCCGGGACAAAGACAACTAGGTTTTTCAACCGTGACACGGACTCACCATATCCTTTGTGGAGACTGAAGACACCAGATGACCATGAAGCAGAGACAGGGATTAAGTCAAAAGAAGCAAGAAAGTACATTTTCAACTGTTTAGATGATATGGCCCAGGTGAACATGACGACAGATTTGGAAGGGAGCGACATGTTGGTAGAAAAGGCTGACCGGCGGGAGTTCATTGACCTGTTGAAGAAGATGCTGACCATTGATGCTGACAAGAGAATCACTCCAATCGAAACCCTGAACCATCCCTTTGTCACCATGACACACTTACTCGATTTTCCCCACAGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yi-Xuan Zhao et al.
Annals of plastic surgery, 79(6), 546-551 (2017-10-21)
Epithelial-mesenchymal transition (EMT) plays a critical role in fibrotic keloid formation, which is characterized by excessive collagen and extracellular matrix synthesis and deposition. Growing evidence suggests that the serine/threonine kinase homeodomain-interacting protein kinase 2 (HIPK2) acts upstream of several major
Zhengyu Jiang et al.
Cell death & disease, 9(9), 847-847 (2018-08-30)
Sepsis is the leading cause of death in intensive care units worldwide. Autophagy has recently been shown to protect against sepsis-induced liver injury. Here, we investigated the roles of homeodomain-interacting protein kinase 2 (HIPK2) in the molecular mechanism of sepsis-induced
Luyang Xu et al.
Theranostics, 9(9), 2712-2726 (2019-05-28)
The molecular mechanism underlying the transition of acute kidney injury (AKI) to chronic kidney disease (CKD) induced by vancomycin (VAN) remains largely unknown. Methods: The mice model of VAN drives AKI to CKD was developed to investigate the role and
Xiaoyan Dang et al.
Chemico-biological interactions, 316, 108922-108922 (2019-12-15)
Homeodomain interacting protein kinase-2 (HIPK2) has emerged as a crucial stress-responsive kinase that plays a critical role in regulating cell survival and apoptosis. However, whether HIPK2 participates in regulating cardiomyocyte survival during myocardial ischemia/reperfusion injury remains unclear. Here, we investigated
Xianhui Wen et al.
Experimental and therapeutic medicine, 21(4), 355-355 (2021-03-19)
Currently, bone marrow transplantation remains the basic treatment for various hematological tumors and irradiation is one of the most important pretreatment methods. However, irradiation pretreatment may result in damage to bone mesenchymal stem cells (BMSCs). The present study aimed to

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.