Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU131091

Sigma-Aldrich

MISSION® esiRNA

targeting human KL

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGAATGACCGACCACAGCATCAAAGAATGTCAAAAATCTCTGGACTTTGTACTAGGTTGGTTTGCCAAACCCGTATTTATTGATGGTGACTATCCCGAGAGCATGAAGAATAACCTTTCATCTATTCTGCCTGATTTTACTGAATCTGAGAAAAAGTTCATCAAAGGAACTGCTGACTTTTTTGCTCTTTGCTTTGGACCCACCTTGAGTTTTCAACTTTTGGACCCTCACATGAAGTTCCGCCAATTGGAATCTCCCAACCTGAGGCAACTGCTTTCCTGGATTGACCTTGAATTTAACCATCCTCAAATATTTATTGTGGAAAATGGCTGGTTTGTCTCAGGGACCACCAAGAGAGATGATGCCAAATATATGTATTACCTCAAAAAGTTCATCATGGAAACCTTAAAAGCCATCAAGCTGGATGGGGTGGATGTCATCGGGTATACCGCATGGTCCCTCATGGATGGTTTCGAGT

Ensembl | Human Hinterlegungsnummer

ENSG00000133116

NCBI-Hinterlegungsnummer

NM_004795

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... KL(9365) , KL(9365)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lin Chen et al.
PloS one, 8(3), e58413-e58413 (2013-03-22)
Klotho was originally characterized as an aging suppressor gene that predisposed Klotho-deficient mice to premature aging-like syndrome. Although Klotho was recently reported to exhibit tumor suppressive properties during various malignant transformations, the functional role and molecular mechanism of Klotho in
Xiaowei Tang et al.
Laboratory investigation; a journal of technical methods and pathology, 96(2), 197-205 (2015-08-04)
Klotho, an anti-aging gene, has recently been shown to contribute to human hepatic tumorigenesis. In addition, it is known that Wnt signaling is antagonized by the protein klotho. Because augmented Wnt signaling has an important role in tumorigenesis of human
Youliang Yan et al.
Molecular medicine reports, 15(4), 1777-1785 (2017-03-06)
Klotho is a recently discovered anti‑aging gene, which has been reported as a tumor suppressor in numerous human malignancies; however, the role of Klotho in human ovarian cancer remains to be elucidated. The aim of the present study was to
Jinpeng Hu et al.
Experimental and therapeutic medicine, 21(5), 486-486 (2021-04-02)
Early reperfusion is the most effective and important treatment for acute myocardial infarction. However, reperfusion therapy often leads to a certain degree of myocardial damage. The aim of the present study was to identify the role of klotho, and the
Lina Xing et al.
Life sciences, 269, 119068-119068 (2021-01-22)
Podocyte apoptosis plays an important role in the pathogenesis of diabetic nephropathy (DN). Astragaloside IV (AS-IV) has been shown to protect against podocyte apoptosis. Here we aim to investigate the mechanism responsible for the protective effects of AS-IV. Diabetic db/db
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.