Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU125271

Sigma-Aldrich

MISSION® esiRNA

targeting human PLAUR

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GACCCTGAGCTATCGGACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCAACCAGGGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTTCCTGTGGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCAGCCCTGAAGAACAGTGCCTGGATG

Ensembl | Human Hinterlegungsnummer

ENSG00000011422

NCBI-Hinterlegungsnummer

NM_001005376

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... PLAUR(5329) , PLAUR(5329)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xin Li et al.
Oncotarget, 8(51), 88645-88657 (2017-11-29)
Dissection and understanding of the molecular pathways driving triple-negative breast cancer (TNBC) are urgently needed to develop efficient tailored therapies. Aside from cell invasion and metastasis, the urokinase-type plasminogen activator receptor (uPAR) has been linked to apoptosis resistance in breast
K D Rysenkova et al.
Cellular signalling, 75, 109741-109741 (2020-08-22)
Urokinase-type plasminogen activator uPA and its receptor (uPAR) are the central players in extracellular matrix proteolysis, which facilitates cancer invasion and metastasis. EGFR is one of the important components of uPAR interactome. uPAR/EGFR interaction controls signaling pathways that regulate cell
Anna Laurenzana et al.
International journal of cancer, 141(6), 1190-1200 (2017-06-04)
In this manuscript, we show the involvement of the uPA/uPAR system in the regulation of aerobic glycolysis of melanoma cells. uPAR over-expression in human melanoma cells controls an invasive and glycolytic phenotype in normoxic conditions. uPAR down-regulation by siRNA or
M Unseld et al.
Thrombosis and haemostasis, 114(2), 379-389 (2015-05-01)
The tumour suppressor phosphatase and tensin homologue (PTEN), mutated or lost in many human cancers, is a major regulator of angiogenesis. However, the cellular mechanism of PTEN regulation in endothelial cells so far remains elusive. Here, we characterise the urokinase
Xuexiang Gao et al.
Oncology letters, 16(3), 3983-3991 (2018-08-22)
Overexpression of urokinase-type plasminogen activator receptor (uPAR) has been implicated in promoting tumor invasion in various cancer types, including oral tongue squamous cell carcinoma (OTSCC); therefore, the effect of suppressing uPAR expression on the invasive and metastatic potential of OTSCC
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.