Direkt zum Inhalt
Merck

EHU121701

Sigma-Aldrich

MISSION® esiRNA

targeting human RRM2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTGTGATTTTGCTTGCCTGATGTTCAAACACCTGGTACACAAACCATCGGAGGAGAGAGTAAGAGAAATAATTATCAATGCTGTTCGGATAGAACAGGAGTTCCTCACTGAGGCCTTGCCTGTGAAGCTCATTGGGATGAATTGCACTCTAATGAAGCAATACATTGAGTTTGTGGCAGACAGACTTATGCTGGAACTGGGTTTTAGCAAGGTTTTCAGAGTAGAGAACCCATTTGACTTTATGGAGAATATTTCACTGGAAGGAAAGACTAACTTCTTTGAGAAGAGAGTAGGCGAGTATCAGAGGATGGGAGTGATGTCAAGTCCAACAGAGAATTCTTTTACCTTGGATGCTGACTTCTAAATGAACTGAAGATGTGCCCTTACTTGGCTGATTTTTTTTTTCCATCTCATAAGAAAAATCAGCTGAAGTGTTACCAACTAGCCACACCATGAA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yueting Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 103, 982-988 (2018-05-02)
Peripheral vascular disease (PVD) is a prevalent vascular disease that affect a large number of patients. The establishment of optimal treatments to mitigate the intimal hyperplasia (IH)-induced restenosis would help relieve the health burden of the PVD. Ribonucleotide reductase M2
S M Du
Neoplasma, 67(3), 567-575 (2020-03-04)
Long noncoding RNAs (lncRNAs) have been suggested to play vital roles in tumor initiation and progression. Recent studies have reported that the lncRNA small nucleolar RNA host gene 16 (SNHG16) is highly expressed in breast cancer tissue. In the present
Zejun Fang et al.
Oncotarget, 7(47), 78055-78068 (2016-11-02)
As the small subunit of Ribonucleotide reductase (RR), RRM2 displays a very important role in various critical cellular processes such as cell proliferation, DNA repair, and senescence, etc. Importantly, RRM2 functions like a tumor driver in most types of cancer
Wei Kang et al.
Oncology reports, 31(6), 2579-2586 (2014-04-24)
Ribonucleotide reductase M2 subunit (RRM2) is one of the two subunits of human ribonucleotide reductase which plays a critical role in tumor progression. The aim of the present study was to analyze its expression, clinical significance and biological functions in gastric
Chunshui Liu et al.
Oncology reports, 42(2), 571-580 (2019-06-25)
Imatinib‑based targeted treatment is the standard therapy for chronic myeloid leukemia (CML); however, drug resistance is an inevitable issue for imatinib‑based CML treatment. Imatinib resistance can be ascribed to Bcr‑Abl‑dependent and independent resistance. In the present study, peripheral blood samples

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.