Direkt zum Inhalt
Merck

EHU120261

Sigma-Aldrich

MISSION® esiRNA

targeting human CRTC2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGCGAGATCCTCGAAGAATGGTGTCCCCACTTCGCCGATACACCCGCCACATATCCTTCACAGGGGACTTGGGAGTCTCTCCCTATAGTCCTGCCTACTTATCTCCTCCCCCAGAGTCTAGCTGGCGAAGGACGATGGCCTGGGGCAATTTCCCTGCAGAGAAGGGGCAGTTGTTTCGACTACCATCTGCACTTAACAGGACAAGCTCTGACTCTGCCCTTCATACAAGTGTGATGAACCCCAGTCCCCAGGATACCTACCCAGGCCCCACACCTCCCAGCATCCTGCCCAGCCGACGTGGGGGTATTCTGGATGGTGAAATGGACCCCAAAGTACCTGCTATTGAGGAGAACTTGCTAGATGACAAGCATTTGCTGAAGCCATGGGATGCTAAGAAGCTATCCTCATCCTCTTCCCGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CRTC2(200186)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xiao Zhi et al.
Liver transplantation : official publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society, 23(9), 1186-1198 (2017-06-08)
Despite its rarity (1%-2%), acute graft-versus-host disease after liver transplantation (LT-aGVHD) has a high mortality rate (85%). A gradual decrease in regulatory T cells (Tregs) correlates with disease progression in a rat LT-GVHD model, and treatments which increase Tregs exert
Laura Rodón et al.
Science advances, 5(7), eaaw6455-eaaw6455 (2019-07-30)
The LKB1 tumor suppressor is often mutationally inactivated in non-small cell lung cancer (NSCLC). LKB1 phosphorylates and activates members of the AMPK family of Ser/Thr kinases. Within this family, the salt-inducible kinases (SIKs) modulate gene expression in part via the
Ali Rastegari et al.
Drug delivery and translational research, 9(3), 694-706 (2019-03-03)
Diabetes mellitus is a chronic metabolic disorder characterized by insulin deficiency and impaired glucose metabolism. Overexpression of cAMP response element binding protein (CREB)-regulated transcriptional coactivator 2 (CRTC2) plays an important role in high gluconeogenesis in patients with diabetes type II.
Ping Li et al.
Journal of agricultural and food chemistry, 67(37), 10513-10520 (2019-09-03)
Amino acids can stimulate milk fat synthesis, but the underlying molecular mechanism is still largely unknown. In this study, we studied the regulatory role and corresponding molecular mechanism of cAMP response element-binding protein-regulated transcription coactivator 2 (CRTC2) in amino acid-induced

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.