Direkt zum Inhalt
Merck

EHU114181

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDX3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGATTTCACCTTTGTGTGTCCTACAGAAATTGTTGCTTTTAGTGACAAAGCTAACGAATTTCACGACGTGAACTGTGAAGTTGTCGCAGTCTCAGTGGATTCCCACTTTAGCCATCTTGCCTGGATAAATACACCAAGAAAGAATGGTGGTTTGGGCCACATGAACATCGCACTCTTGTCAGACTTAACTAAGCAGATTTCCCGAGACTACGGTGTGCTGTTAGAAGGTTCTGGTCTTGCACTAAGAGGTCTCTTCATAATTGACCCCAATGGAGTCATCAAGCATTTGAGCGTCAACGATCTCCCAGTGGGCCGAAGCGTGGAAGAAACCCTCCGCTTGGTGAAGGCGTTCCAGTATGTAGAAACACATGGAGAAGTCTGCCCAGCGAACTGGACACCGGATTCTCCTA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Min-Yao Jiang et al.
Oncotarget, 8(46), 80295-80302 (2017-11-09)
Benign prostatic hyperplasia (BPH) is one of the most common diseases in the senior men and age plays an important role in the initiation and development of BPH. Mammalian cells primarily use the autophagy-lysosome system to degrade misfolded/aggregated proteins and
Inah Hwang et al.
Free radical biology & medicine, 131, 162-172 (2018-12-12)
Chronic kidney disease (CKD) has become epidemic worldwide. Mitochondrial reactive oxygen species (ROS)-induced oxidative stress is an important mediator of CKD, and Prx3 plays a critical role in maintenance of mitochondrial ROS. The present study examined the role of Prx3
Hua Zhang et al.
Oncotarget, 8(2), 3471-3480 (2016-12-15)
Peroxiredoxin (PRDX) proteins are involved in carcinogenesis. PRDX3, which is predominantly localized in mitochondria and up-regulated in several human cancers, seems to confer increased treatment resistance and aggressive phenotypes. This study examined the expression profile of PRDX3 and its possible
Brian Cunniff et al.
PloS one, 10(5), e0127310-e0127310 (2015-05-27)
Dysregulation of signaling pathways and energy metabolism in cancer cells enhances production of mitochondrial hydrogen peroxide that supports tumorigenesis through multiple mechanisms. To counteract the adverse effects of mitochondrial peroxide many solid tumor types up-regulate the mitochondrial thioredoxin reductase 2--thioredoxin

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.